Description :
From Genome Similarity Track
Location :
Scaffold_3913:156- 1195
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3913-snap-gene-0.1Pectin lyase

Sequence
1039 bases(100 bases per row)
GTAGTTGTTGATCAGGTTGAGGCGCGTCGCCGAACCTTCAATGATGAACACCCAGTAGTGGCGGTTGTCACAGGTGGCCGAGTACGGGGTCACACCGTCG
AACTCCGAGTTACTGATCGTCAAACTCTTGCAACTGGCGGCGTTCGTGGTCATCATCTGGCGACCGACCAACGAAATCTTGACGTGGTCGATCCACACGC
GTTCCTGAGTGGCGCCCGTCGCCGTGCCTTGGAGGTAAAGGGCATCACCACCCCAGATCAAGTGAGGGTTCAAGTTAGTGATGTGAATGTTCTGGACGAT
GACGTTGTTGCCCTGGATCCAGAGACCCTTACCAATGATCACACCCTTGAGTCCATCACCACGCAAGGTCTTGTTGCTGTTGATGATCAACGGGTTCTTG
GTACCTGCGACGTCGTACTTCACAGTGACCGCCTTTCCCTGGATACAGCCACCGGTGTTGGCCATGCCACCGCTTTGGAGGATCACATCCTGGCCCTTAT
AGCCATTATTCTTCGCGAGACACTGCTGGTTCGAGAGTGGACGGCAACCAGTCTCGGTCTTCGTACCCTCAGTCCCACGGAAGTCGAAGGTCTTGTTCAA
GATAATCACACGCGGCTGGCTGTCCGAGAGGTACGACTTGAGCTGCGCGATCGTCGTCGGGTACACTGNNNNNNNNNNGGCCGCGTTGCCTCCGCCGGTG
GTGCCAGCAGCGAGACCAGGCGCCGTGCCGATCGTGAGCGACGTGACCGTTTGCACGAGGAAGGCCGCGACACACAAGACGCCGTAACGGATGAGCTTCA
TGGTGCTGGGAGGAGTTCTGGGAGTGGGGCTTCGTTTGCAGACGAGTGCAAATTGGAGAATGAGATCGAAAGCAGCGGACCGCCTGGCGCAGGAGAAGCT
GACAAAGTGCGAGAGAGAGAGAGAGATGCACAGAGGAAACAGTTGAGCGTGTGCTGTAGACAAACCTGTCCTTTCGTGTCGGTCGTCCACTGTATGGACT
ATGCCGCTCATCTTTAGTGAGACGGGTGCACAGCCGAGC