Description :
From Genome Similarity Track
Location :
Scaffold_391:15599- 17663
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_391-snap-gene-0.14Myosin

Sequence
2064 bases(100 bases per row)
ACCTGCATGAGGCGTCAATCCTCCACTCGCTGCGCATCCGCTACGAGCGCGATGCGATCTACACGCGCATCGGCGAGATCCTCATCTCGATCAACCCGTT
CAAGAAATTGCCGCAGCTCTACGGCCGCGTGATCATGGAGGACCACGCCCACGAGGGCATGTCGCTGCGCACCGCCGAACCGCACCTGTTTGGCATCGCC
AAGGCTGCATACCTCGACATGGCGCGCAACGCTCGCAACCAGTCGATCCTCATCAGTGGAGAGAGTGGCGCAGGGAAAACCGAAGCCACAAAGATCATGA
TGAAATACTACGCGCTCACGTGCAGCGCGTCCGCCCACGCCGATAAGACCGGAGCCAGCAGTAACTCCAATAGCAACATCTCTTCTTCCACAACGTCAAT
CGAGTCTCAGGTGTTGCAGTCGAATCCGATCCTCGAAGCGTTCGGGAACGCGCGCACGACGCGCAACGACAACAGTAGTCGCTTCGGCAAGTTCATCGAG
CTCCAGTTCGAGACCACGAACGACGCGCACATCATCGCCGGCGCGCGCATTCGCACGTACCTGCTGGAGAAGATCCGCGTGATCAAGCAGTCGCTCAACG
AGCGCAACTTCCACGTCTTCTACGAGCTGCTCGGCGCTGCGGCAGCTTTTACAGAACAGACTCAGAAAGGCACACCCGCCAGCAGCAAGTACCTGTCGAG
TGAGGCAGTCGCGTCCTGGCAGCTTCTCGACGTCACACAGTTCCGCCTCGTGAACCAGAGCGACTGCTACACGCGACGAGACAGCGTGGTTGACGCCACG
CAGTTTGAGAAGACCTGTCGAGCGATGCACCTCATCGGCATGAGCGAAGACGAAGTCGCGAACGTCCTCGAGATCGTCGCGGCGATGCTGCACATGGGCA
ACGTTGACTTCACCGAGAGTCACAGCGAGGGTGACAACGTGCTCGAGGCACACATCGTACAAGAGAATCCGGTCAGCGGGGTTCGCCACTTCGATATCGC
GGCACAGCTGCTGCGAGTCTCGCCCGAGCAACTCGAGAACGCGCTGACGACCCGCCAGCTGCACACTGCGACTGAGTCGCTCATCGTGCGTATGGACGCT
GCGCAGGCGGAGAACACGCGCAATGCGCTGCTGATGGAGTGCTATCGCCTGCTCTTCGAGTGGCTCGTGGGCCGCATCAACTCCAANNNNNNNNNNTCCG
CCGCAACACTGCAAATGCGCACGAGAACAAAAAGTCCGAGTTCATTGGTCTGCTGGATATCTTTGGGTTTGAGGACATGGCCACGAACTCCTTCGAGCAG
CTCTGCATCAACTACGCGAACGAGGCGCTGCAGCACCAGTTCAACGAGTTCGTCTTTGAAGAGGAGCAAAAATTGTACAAGGACGAGGGCATCGGCTGGA
CGTTTGTGGACTTTCCGAACAACCTCGCGTGCCTCGAGCTCTTTGAAAAGAAGCCGATCGGCATCTTCTCGCTCACGGACCAGGAGTGTCTCTTCCCACA
GGGCACGGATCGCGCGCTCGTGGCGAAGTACTACGGCGAGTTTGAGAAGAAGATGGCGCACCCGCACTTCCTCTCCACCGCAGGCTTCCTGCGCCAGACG
CATTTCATCGTCGCACACTACGCCGGACGCGTCACGTACACGGCCGAGGGCTTCCTTGCAAAGAATAAGGACTCGTTCTGCGAGAGCGCAGCGCAGCTTC
TCTCGAACTCGTCCAGTCCGCTCATCCAGAGTCTTGCAGCTGTCGGCAGAGGCGGTGCAGAGGATCACACTAGTGCGCCAGCAGCAGACCATCACCCCAG
TGACGGAAGCGCAGCAGGAGCAGGACGTGTAGTGAACACCCGACGTGCAAAGTCAACCATCGGGGCGATCAGCGTTGGCACGCAGTTCAAGATGCAGCTG
AACGAACTCATGGAGATCATCCGGTCCACGACGCCGCACTACGTGCGCTGTATCAAGCCCAACGACACGAATGTCGCAAACAACTTCCAGTGCACGCGTG
TGGTGGAGCAATTGCGAAGCGGTGGTGTGCTTGAGGCAGTGCGCGTGGCTCGTGCGGGTTTCCC