Description :
From Genome Similarity Track
Location :
Scaffold_90:155938- 157619
Sequence
1681 bases(100 bases per row)
ATTTGCTCACCCATTTGTAGAGTTCGGGCCACCAGTAGCGTTGACTTACAAACCCATAAGTCTTTTCACGACCCAAATGCCCACCGAGAGCAGTATCATG
GGTGCAAGGTGGATTCGATACTTTAAATTCTCATCGTGAGGTACAACATTGTGAGCAGGATTCGTTATATCTGTGCGATAGCACAAGAGACCATTATCGA
TTGAATATCAATATAGGCCGGCACGCAATCGTGCCGAAAATTGACTGTCCGAGTATTTGTACTCATTACTCTTAAGGGCATGAAACAATGTCACACATTG
AGAATCTTGTGGATATGCCACACGAATTAACTCCTCAATATAAGACGACATGTTCGTGACATGAGCAAGCTCATTATCGAGACAGCGAGATAGGGCATCT
GCTGACACCTTTTGTTTGTCCGTTTTGTACTTCACCTCGAAGTTATATTAAGCAAATAAGGAAAGCCAAGGAGCCATTATCTGGGAGATGTGAGGCAACT
GGTTCGCCGTGAGTAACGATGCGTAATCCGTGTAGACGACAAATGGCTTGGAGCCAAGCAGTCGGTCCCTAAATTTGACGAGAGCATACTTCAAACCAAG
TAAGTTTATCAGCAGCTTTAAGGTGACCAGATTTAACGGCGAGAACTAGCTCTCGGTCTTCAGCATCTTTTTGCAACAAGGCGCTGACTAAGGAAAAGTC
GGATGCGTCACAGACGACACTAAAATGGTACTTAAGATTTGGCTACGCCAAAATGGGAGCACGGAGAAGACTTCCCTTTACTGCTCGAAATGCGTCAGCA
TGGTTTTTTTTTCAGCGCCAATCTGCGTCTTCTTAAGGAGATCAGTTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTAATTGGC
AAGGCCAAGCCACTTACGCAAGTCTTTTTGATTCTTAGGAATCGACCAGTCAACTATACATTGACCTTAGCGGGATCCGCCCTGACACCGCGCTTACCAA
TGAAACATCCTAAAAAAGGAATCTCCTCTGCACCAAAGATTCATTTAGACGCGTTGGCGTACAATCTTTCGTGCGCATACACTCTAGAACAGCTCGCAAA
TGACCTATGTGGTGTTATTAACATCCGACCGACATTGCTCGGTACGACTATGGACAAATATGTCAGAAAAGTATTTATGTGCATAATCCCAATGGGGACG
GAAACGCTGCGTCACCAGAAAATTCAATGTGACTGGTACGTTTTATAGCCCTTCGGGTATCACCAGCCATTCTCATAGCATACTACTCGGAGTGCTCACT
GATGTAAGCGGGATATCACTCGCTCGCATGGGCAATTGATGATATCCATCGACCAAGTCAAGTGCCTGTACATAGCACAACCAACCATGTTGTTTTGGAG
AACATCCTTTCGAGGAATTGGTGTCTGTGCCGGAATAGTGGCCGCATTAAGCTTGTTGTAAGCATGCACAATACGCCACTTGCCGTTCGGCTTTTTGACA
CAAAAAGTCAGTGTCGAATGTGGAGATTGACTCTCACGTACCATTCCTGCCTCGTGCTTGGCACAGAAGTAGTCATCAATGAAATCACATTGCTCCTTAG
GCGAGGTCCACTATCGTGTGACACAGTATTTAGTCCCCGGAACTAAGTCAATTTCGTGGCGGACACCTCTATCTTGAGGTA