Description :
From Genome Similarity Track
Location :
Scaffold_2353:1559- 3021
Sequence
1462 bases(100 bases per row)
GGACCTCAATCCGAGGGTCCCTCTGCAGGATCTTTTGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGTCCCACCGGGAGCTTCACCTC
TCCGAAAGATTCGATTTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTTTCTGTAACGGCTGGATCCCACTGACACGTATCCAGGTCGCCTAGGGATA
CCGTCCTTCGCCAACCATCGTCCGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGGGGTATTGTGATCGACCTGGTC
CTTGGATTACGGTAGGCACCCACTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTTCTCCGGG
CTCGATCCAGGTCGTTTTATCCGCCCTTATGATCCTCATCTTCGCTCCGTACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAA
AGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCTACCCAAATATCAA
ACCAGTACACCAAACAACCTGCCAACGTGATCTTGATTCGCGTTCTCCCGCTCATACGGTATACGCCTTCACCAATCCCAACTAAATCTTGGATCCGACT
CCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTGTCTAGTATAGACACCTCGGCACCACTATCTACGAGTAGGATTGCTTTCTCATTGTTGATC
TTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGTGATCCAG
TGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCTCCCTTGGTAGGCTCAAACCATCGACCTTGTTGGCGTTTTTCCCAATAACCTCGTGCTTCTCC
CCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCACACTAGAGATCTTGACAACTGACACTTCATGTAGATCACGT
GTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGACGTCTTGCTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGAT
TCAAACCCGGCGAGCGTTCCAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCGGGTTGTAG
AATTCTTCCATCGGACACTTGCCGACGTCGTCAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCCTTCTTGCCACACTTCT
CACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACAC