Description :
From Genome Similarity Track
Location :
Scaffold_2871:1559- 2589
Transcript NameFunction/comments
Phyta_totarag14893hypothetical protein PHYSODRAFT_340298

Sequence
1030 bases(100 bases per row)
TGGCAGCACTGCCTGAGCTGAGAGATCTCAGCCCTGAGGCAGACCTCGCAAAGGCTGAGGTTGGTGAACCTGGAGTCATCACCCCTGAGATGAATGCACA
AGTACAGAAAATTCTGGAACGGCATCATTCCAGTTTTCTTGGTGATGGTAATGCGGTACCTGCCCCGGCCAGAGGTGTTGTTTGTGATTTGGATGTCGGA
GATGCTAAACCTGTCGCTCAACGATCTAGACAAGTACCTCCGCATCAACTTCCGAAAGTATACGATCTGTTCAAGAAACTGTTGGAAACTGGGCTCGTGG
AATACTCGAACTCAGATTGGGCATCACCGATCGTCAttgtgatgaagaagaacggtgTTGGCATCCGACTCTGTATCGATTATCGACTGGTGAATCAGCT
GACCAAGCTCATGCACTATCCTCTACCCTTGATTAACGATTTGTTGATTGGGTTTGAGAGTGCAATGTGGTTCCTGAGTTTGGACATGGCTAGTGGCTTT
TGGGCAGTGCCGATGACGCTCCGAGCGAAACACATCTCGGCTTACATTTGTCCGCTCGGTCATTTTCAGTGGACGCGCATGCCGTTTGGTTTGAAGAACG
CACCCCTGATCTACCAGCAGATGCTTGATAACTGTCTCTGGGGATTTGTGCGACTTTGCCCAACGAGGAAGCTCAGGTGGACGCCGAAGTGCTGGAGTTC
TTGGGAATTGAGGCAGATACCTCAGttgtcagcagcaaaatgccAGTGTTGTCTGAGGAGCTAACTGTGTTCTGAAGAAATATCCCAGCCCCACCTCAGC
TGAATCCAGTCCTGGGAAGAAGTTCCTACATCNTCAAGAAGACAATTTCGTATTTGTCTCATGAGATTGGAGCGGAAGGGATCCGAGCTAAGCCGAAGAT
CGCCAAAGGTGTGCGGAACCTGCCGTTTCCGTCAACTCTGAAAGGTGTGCAGTTATTCCAGGGAAGTTTGAACTATtacaacaagttcatcaaAGATCTT
CCAGTCGTGGCTTCTGTGCTGTATGAGTTG