Description :
From Genome Similarity Track
Location :
contig_30:155885- 157426
Transcript NameFunction/comments
g6247.t1hypothetical protein

Sequence
1541 bases(100 bases per row)
TGTCGTCACCCACTTGGACGATTGCTCTCTGCAACAACCAAGGCAGCAAGGTTACAAAAGTTTACAAACGCAGAAGCAGGACACACCATACCCGTCCAAG
ATGTTGACCGGTGGGAAGTTCGGATCATACGAAGTCACCGCCGTCACCTGGGCGCCCTCTTCATCCAAAGCGAGCTCCATCGCGACCGAGACGACTAACA
GACTTTCGGGGAACTCGGCTCTTGTGATTGTGGTCTGCCTTCTGTCCTAAAAACCGCACAGCTTAAACTTAGAACGACGCCACAAGAACAAACATAAGAA
TAGCTTGGGACGCACTCATACTTATCATCTCCATTTGCACAACGCGGAATGCACAGGCGACTTTTACTTGAACACCCTCCTAGATACCGACGTCGCAGGC
CACAGCGGGTGGCTTTTTCACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTCTGCAGTCGCGGGCTCTAAATCATGTTGGAGGCTGCCCAAAACCCAATT
CACTGGACAACCGCCGACCTACTTACGTTGTCAGCGGTGGCTCAATTGACTCCTTGTACAGCCTCTCGAAACCCGCCGACAAAATGTCGGCTGCACGTGT
GATACCCGATCCATCGTCATTAAAGAGCTTGCAGTTCGACCACATAAGGCGAATGTCGTTGGCAAAGTGCGTAGAATCAAGCTCCTTGACACCAGCCGCC
ACTGTGTTGCTGTCCACAATGTACGCTCCCTTCTTCAGCTTATCCTCGATTGTCGACAAGTCCATTGGCTGCTTCACCACCCGAGTGTACATCGGAATGT
TCTCCACGGGCGTGAGGAATGGCTTTGAAAATGGATGCGACTTCAGACACGTGACAATTTTCAGGCACTTGTCCAGCAAGCCTTGCTCTGAAGCCACAGC
TGTGGAATACAAATCGAAACGAGACGGCTTCCGACACTCGGCGCATTGCCAATCCCCCTCCGGTAAGTCACTCTCCTTCATGTGCAGACACTTTAAGTGG
AAGGAGCGCGGGCACTTGTCGCAGCACACCAGATCACCAGCACCCTGACAGACCTCACAGAAATCCAAGTTCGTGTCCAGCTCGCTATCTGAATCATCGC
CCTCGTCTTCATCATCTTCGTCGTCTTCTTCGTCCGCTTGGTTGTACGTTTCATCCTCTGTTTCTTCTTCGTCTCGTTTCACTCGCTTGGCATTCTTAGG
AGGTCTACCTCTTCCCCGCTTTGGGGGCGGAGTAGATTTACGCTCTTGTAGATTCTTCCTCTCTGCACGAGGACCAACTGAAACACTGCTCGGTGTATCG
TTTTTTAGCTGGCGCGGGCGACCTGGTCCATACGCTGGTGATGACTCCGCTGAACGACTTTCCTTCGGATGACGTTGACGAGCAGGGCCGTACGCCGGTG
ACGATTCCGCTGAACGGCTTCCCTTAGATCCCGCCTCGGCTGTGTTTGCCTTCACACTACCATCTAGCTGGGATGCAAGTTTTGATCTTGCATCAGGCGG
ATATCGGTTTTTCTCCTCATCGTTGTGTTCACTAATAGAGC