Description :
From Genome Similarity Track
Location :
Scaffold_53:155802- 160256
Transcript NameFunction/comments
Phyin_T30-4PITG_17251Protein kinase%2C putative
Phyin_T30-4PITG_17252Protein kinase%2C putative
Phyin_T30-4PITG_17253tRNA (Cytosine-5-)-methyltransferase NSUN2-like protein

Sequence
4454 bases(100 bases per row)
CGACAATTGCACGAGTATGCCCGTCGTCGTGCGTCTCTCAGAGTCGACCAAGTGTTCGTTCCGCCAGTGCGCTCCCGTCGAAATCAACAATGCTACCAGA
TTCAGGAATTCCGAGTGTAGCATCACGAACCGGTTCGCGTACGCCCGAGAAAAATATGGGGAATACAACTACATCGTCGTAGAGGACTACGGATTTGCCG
GGTGCGAAGATCTACGCTTGACAACGGTTCTACCGGTCTCGGGTGGCTGCTCGGAATCGCCAGTAAACGGGCAATATTCAATTGTCTCAGCTCTGTTTGC
CAATGGGTCGGCGTTGGTAGCGTTGTATCCAGATGAAAACTGTGAGGGAGACACCTATATGAGTTTCATTTTGGACAGTGGTAACATTTCGAGCGGTGAC
TGCGTCCAAGATTACTACAAATTCTACACGAGCGATAGCGAGATGATTGAGGAAATCAGTAGCGGATCAGTCGATCCAGACGTGGAAAACAGGTCTAGCG
ATCAAGAACCAAGCTCACACCTGCAATTAGTAACCGTAGTAGGCATCGTTTTAGCTGCAGGTGTGATGGGGTTTATGACGGCTGTCTGCTGCTGGAAGCG
ACGAATGCCCCACGACAAGCAGAGTACTGAGGACCTTGATGATTTTGTGGACTGCGAGCGGTACACGTCTCTGCGAACCAGACAGAAGAGCGCAGCGTTC
AGCACAGGTGGCACCAAGAGCTCGTACACAAAGGAAGGGATTAAAGAGCAGCATAGTATCAGCTACTTCTGGGACGACGACGAGATCGCTGCAGCACGAG
TCGACCGTGACAAAATCGACTTTGAAGGGGTTATAAGCCATGGCGGATACGGACAGGTCATGTCGGGCTGGTTCAACGGTCAGCACGTCGCAGTCAAGAT
GCTGCTACCGGAGAACCGCAAGAGTATGAAGTATCTCAACTCATTTTTGGAGGAAGTGAAGCTCATGTCTATGCTAGAACACCCTCGCATTGTGCAGTTT
GTTGGTGTGGCTTGGGACTCGCTGTCCGACATGTGTCTACTGACCGAGTTCATGGAGGGGGGCGACCTACGATCACTTTTAGCAGGTTATGAAGTTCAGA
AGTACCCTGTCGGCTTCAACATGACCAAAGTGACCATCGCGCTTCATATTGCACACGCACTGACGTATCTGCACTCACTGGACCCGCCAGTGTTGCATCG
CGACCTTAAGTCGAAGAACATTCTATTGAGCGCCACACTGGACGCGCGGCTATCCGACTTTGGCGAATCTCGAGAAAATATCGACGAAACTATGACTGCA
GGAGTGGGAACGTCGCGCTGGATGGCCCCGGAAGTGATGATGGGGGAGAGATACGACGACAAGGCCGACGTGTTCTCCATGGGCGTGGTGCTGTCCGAGC
TGGATCTCCACGCTTTGCCCTATTCGCACGCCGTGGAGGATAACAACCCAGGTCGCAAGATTCCTAGCACAGCGATTGTGCATTTGGTGGCGATGGGGAA
GCTCCAGGTTCAGTTCTCTAGTGTCGGACCGATGGCTGATCTGGGTTTGTCCTGCGTTGCAGTGAACCCTGACGATCGGCCGACCGCAGCTGAAGTGCTT
TACAAGCTGCATACTGTTTTGACAACCGAGTATGATAGGGGTAGTTGGGATGAATAGTGTAAGGGTAACAGTGGATAACGTATTGAGTTGGGAGTTCATG
TATACTGTAATCGAAGCCCTCTTTGCTTCAAGCACTCGTCATGTGTCACCAGCCTTCGGTCCACCTTGAAGGGCAGCAAAAATGAAGTCAAAGTCTCGCT
CTTTTCAAGCGCAGGCTTGACAAAAGCACACCGAGATACTATCTCAGATAGGTCATTGTGGCGGTGACACCACCGTGGTATTCATCAATCTGCTACATGT
ACTCTGTTCGCTACGAAAGAGTCGATTTTCGCGCCTTGCTCCGTACGGCTTCCCGCTGTGTCGGTGCTGTCCGGCTTTTGATGATCGATCGCCCGTGCCA
AACGCCTGCCTCAATCCACCGAGATTTTCGCCACGATGGGGAAGCCGCGTCTTCCATCTGTCTCCCAATCGCCGGGATCTGGAAGGAGGGCGCGGCCTCG
TCGCTCGACGCTCATTCTACGATCACCGTCTTTTAGGCAAACTTCCGTTCCTCATGTCTTGGGTCAGGGCGGTGGCGGTGGCCCCGCTGCTCCTGGCGCC
CTCCCTCGCGACGAATTGGTCCGCGAGGGAGCTCTACTCAGGAAGCCACTGCGCAGGGACACCAAACGTGCTCAAGATGATCGAAACAGATACCTGCGAC
CCGCAAGCCTGTATGCCACACGATCTCGGGGGCTACACACTGTTCGTGGCCGCATCATGTAACGTTACGGACCGGTTCAAGTACACAGGGGAGCGATTCC
TAGGTTTCGACTACGTCATGATGGAGGAGTACGACGGTGTCGGGTGCGCACATTTGGTCCAAACTACCGTCTATCCAGCGTCGGAAACGTGCGAGAAATC
CTCTGCACTAGCCAACACGTCCGACATCGTCAGTCTCTTTTCGAACGGTTCAGCGGTTGTCCTCCTCTTCGACGACGGAGACTGCGGTGGCTCCCCCTCA
CTAGCGTTTGAACTGGACAGAGAGGAAATCTTGAATGGCGAGTGTGTTCAAGACCACTACAGGTTCTACACAGGCACGGCGTCCAGCAGAACTGCCTCTA
GTAGTTCAGCGTTCTCATACGAAAACAGCCAAGCCAAATGGACCTTCAGTGAGGACTCAGATGGTCTCGGTTGGGGTCCCATCACGGCCATCGTGGTCGG
CTCGGTTGCTTGTGTCGCGTTCCTAGCTTTCGCCACCTTCAAGTACGTTCGACGTCGTTACGATGATAACCTTTCGAAGGATTCAGGTATCGCTGCTCTG
GCTGCAAGTTACGCCGGCTACCCGACACCAGAGAGCGCTCTGAACGCGATCACACTAGGCTCCGAAGCGTCGTACTCACAGGGAAGTATTGAAGACGAAG
CCAAGCCGCGAAGTCGACGCAACTTGAGCGGTATCAGTGGCTTGTGGGAGGATGAGATCATCATCACAGCTCGCGTCCCACGAGAGAAGGTTATAGTACA
AGATCTTATCAGCCGAGGAGGCTACGGGGAAGTCTACTCGGGTATGTTTAACGACGAACCCGTCGCTATCAAGATGCTGCTGCCAGAAATGCGCAAGAGT
ATCAGCCACTTGAACGCCTTCCTGGCGGAGGTGAAGCTCATGGCCTCATTGAATCACGAACGCATCGTTCAATTCGTTGGCGTAGCGTGGGATTCACTCA
CGGACCTCTGTGTCCTCTCGGAGTTCATGGAAGGTGGCGACCTCCGCACGCTTCTCAAGAACTGCGAGGAGCACAAGACGCCTCGAGGGTTCGACCGGAG
CAAAGCTACCATCGCGCTTCACGTTGCACATGCACTGACTTATCTCCACTCGTTGTCACCGCCAGTTCTTCATCGCGACCTCAAGTCCAAGAACATTTTA
TTGACTTCCCAACTGGATGCGAAGCTCACGGACTTTGGCGTCTCGCGTGAGAGATCCGACCACACTATGACTGGCGGTGTCGGATCTTCGCGCTGGATGG
CGCCGGAGGTGATGATGGGAGAACGGTACGACGACAAGGCCGACATGTTCTCGTTCGGTGTGGTACTGGCTGAACTGGACCAGCACCTGTTACCGTATGC
TAATGCCAAGGAGAACAGCGACTCTGGTCGAGCGATGCCCGACTTGGCTATCCTGCAAATGGTCGCTACTGGCAAACTCCGCATCGAGTTTTCGTCGGCA
GCTCCCAAGGCGATCAAGGAACTCGGCATGGCCTGCGTGTCCATTGACCCCAAGAACCGACCCACAGCATCAGAGGCGCTGTACAAACTCCACACCATCT
TAGCTCGCGGACTTTAGAGACAACCCCCGTCCGGTAAAATATAAAGAGCATCATGCTCAAATTTTAGACGCACTATCCGCTTGCGTGCATTACGTATTTT
CACAAATACTTGGGCTGTCCAACATGTCCAAAACATTCCATAAACTTTTAAATGATGGGAAATCCAGCCCTACCGTTTTACTTGGAAAGATAAAACCATT
TTTTATGCATACATGTATTAAAATCGCTTTAGACTTTTCAAAGGAAAGGTAAAACTTAAGCGCGTAACTTTTCAAGTCAAAGTAATGGACCAAAAAAATT
GCACGCAGCTTTCATTTACTGCTGCGATGCGTGTGCGATGCGGTCTCGCGTGGATTTATCGACGAGTAGAGTGAGAGTCTTATCGCCAACCCACACTGGA
AGTGCAGTGGGAAGTTGGCGGTTCTTCGCCGCATCGCGTTCAGCTTCCGGTAGAATCATCAGCATGGGACCGACACCGGAGTGGTCTCGCACAGCTCCAG
CCGACTCTTGTAGTAGTTCGCTAAAGCGCTCGAGACCGACCGCAACTTGCTTGG