Description :
From Genome Similarity Track
Location :
Scaffold_78:15578- 17412
Transcript NameFunction/comments
Phyra_82806Hypothetical protein

Sequence
1834 bases(100 bases per row)
TCATTCTTGAAATCACCCTCGGCCGCGCAGATGTCCAAACAACCATCTCCGTCTCCGGTGCTCACACCCCAGTTGACCCCTTCGGTCACCGATTACGGGA
TCACCAAGCTCTGGGATGAGCGCCCCGCCAAGTATGCCAAGCATGTGCTCAAGAACGTCTGCATCATTCTGTTTATCTTGTCGGCGTTCAGCCAAGTCAC
GAATTTTGCCATCGCGCAGTCGCTCAAGAACTTTTTCCAGAAGCTAGGGTGGTCCAACAAAGGCTCCACCTCGATGAAGCTGACGTTCGACTCTCTGTGT
CAGTTCATGTGCATCATTGCTGGCTACATCTCTGACGAGCGCCTCGGGAAGTTCAAGACGTTGCTGTCTGCTGCCACTCTCGACTGCTTCGGCCTCCTCC
TCCTCGTCGTTGCTGCGTTGCCCACAGTGTTAAGCCACGTCGGTGCAAGCAAGACTATCTTCAACATCGGTCTGTTTCTCGGCGTTGCAACCTCCCAAGT
CTACTTATCATCTCGTATGGAGGTGATCAGTTTTCACCCGCGGCTCCTGCGACCGAGAAGTCTCTGTTTTTCAGCATCCAATATGCTGTCGCGAATGTTG
GTGCGTTTATCGGCTACGCTGCGTTCCCGTACGTGTCCATCCACGGAATGGGTGCTATTCCCGCGGACTACGGCTACGTCAGTGTGTATATTGCCGGCTT
CGCCATGGTTCTTTTGTTCCTGGGGCTACTCTGGATCTCTCGCCAACGCTACGTGAACGTGCCTCCGACGAGGGAGTCGATCGCCCTAGTGATCAAGATC
ATGACGACCCACGCGAAGAAGAACTTCAATGCCAAGATGATCACGCTCGGCACAATCCTGTACGTTGCCGCGTTTGCGTTAAACATCCTGGCTTCCTTCC
TGTCGGACCATGGCGAAGTTGGTCACAACATTTCGTACGCATGTGGTGTGATGATCGTGGTTGCAACGTTCCTCTGGATCTACTTCGGTTGCACTTCGAC
ATTCATGGAGGGCGCTAAGGATACAGTCAGCGGTCAATTTGACGGTGACCTCGTGGATGGTGTGAAGCAAGTGATTCGGATTCTGCCACTCAATGCTTTC
CAAGTGGTGTTTTGGATGTGCCAGAATCAGCGAGGTAACAACCAATCGATCGTGCAACAGACAGATATGCGTCTCGGCAGCGGCCCGGACGCTAGTCAAA
TGCCGGGCCCCTCGGTTCAAGCGTTTAACCCCATAGGCTGTATGGTCTTCGTCGCACTCACCGAGAAGGTGGTCTACCCGATGTACACGAAGTTCGTTGG
AAAGCCACCGAGTCGCTACGGCAAGGTGCTTGCCGGCTACTGCGTCGTCACTGTGGCCATGCTTTGGACGGGCTGCTACGAGATCATCCGTCGCAGCGCC
GATCCGCTCACCTATGTGGACTCTAACGGTGAAGCTCAATTCATCCTGAACGACGATGGAGGGCAAGTGATGAACAACATTCCGTGGTGGACGGCCATCC
TGCAATACCTATTGGTAGCGCTTTCGGAGGTTCTGGCTGCTGTTGCGTCCTACGACATCAACTACTCGGAGGTTCCGCAGAGTATGCGCAGTACGTCCAT
CGCGCTCGCTTTCTTCGCCAACTCCATGGGCAGCACACTGCTCTCCGTCCTCGTGCTTCTCTTCGGCAAGTACATTCCGTCCAACCTGAACGACGGCCAC
ATGGAGTACCTCTACTTTACGCTCGCCGGCATCATGGTCGTGACCATCTCCCTGTATGTGGTGGTGATGAACAAGATGCAGTTGGGGATGAATCCTCGTG
TGGGCAAGTCAAAGGACAAAGAGCAGGAAGAAGA