Description :
From Genome Similarity Track
Location :
contig_66:155721- 157219
Transcript NameFunction/comments
g11310.t1hypothetical protein

Sequence
1498 bases(100 bases per row)
AGTACTTACTTGGAGCCAATGTTGAAGTTGACGTTACCAGGGATTGATGCGAATGATGAGAAGAAAACACAAGCGACAGTTCAGCTGTATTTTCACATAC
TTTCGTGGCTGCCCCTAGTGAATGATCCGGCTAAGGGTAATTTCCAGGCAACGAAGCAGCGAGGGGAGCTGTCAAACCAATTGTTTGCAGACATGAAAAG
CAGTTTGTTTGCTGAAATCTGTTCTCTGGGCAGTCAAATTGACGAAAAAATGTGGGAAACTGGACCGTTCTTAGAGGAATGGACGTTTGCAGTGTTGGAT
CGTTGCTTTCAATTCATTCAGTCGCGTTCGGGTGCTAGGTCTGCCTCGCCCAATGCTGACAGAAGCGGGAAATCTTCCAAAAGAGATGGAAGTGAAGACG
CGATCGTATTGCAGGTTTTGAACCTATTGGCCATTTTGTATGTACAAATGTCCCCAGAAATCTACACGCAGTGCCTGCGCAAGACTGTGGCTTTTGTGTC
AAGTGCGTTCTACACTACAGCATTTGGAGGAAAGGTAATATCGACGTTGATCTTCAATTGCATGCAAGGAAATCCTTCCGAAGCCATCGCGCGGTTCATG
CCGCTTGTTCTGGAGAATTTTCACGCTACGAAAACCAGCATTGATGTGGTCGGCTTGATGACGAACGAAAAAGTGTGGTACTTGCAGATTCTCAACGGCT
TAGTGCGCTTTAGCCACCAAGATGATCGCATTCTACTGCGCTACCAGCCCGAACTGAAATTGATTCTGGCACAGTTTTTGAGCAGTGACGATGTCAAGGA
CGTCTACGAAGCTGCTGGTGCTGTATTACGGCATTTGCTCTCGGGTCTTGTAGGAGTTTACACGCACGACTTTCGCTCGTTACCTGCTGCCGAGTGGGTG
GATGCAACATCTCCTAACAGCGGAGCTTTCCAGTACATGGGCATTGGAATTTCGCAGAACAAACTTTCGGTGAAATGGCACGAACCGAACGAAGCAGAGC
TTTCGTTCGGATTTAACCTGCTGCAAGATCACGTAGTTGGAGCACTCGATGAGTTGGAACGCATGAGACAAGCCAAAAACCTAAATGCTCGTACGTGGAC
GCGCCTTCTAAATCAAGTGTTTCAGGGTCTTTGTGGGGCTGCAAACGTGCTGACTGATGACAGTGTCACGGAGGAAGGTGCGCTCTTGAGTGGTGCAAAG
CTACTACTACTGAAGGCACTTGAGAGTAATAGGGATCTTTTCAAACAAATTGCGTCATTGAAAAGCTCCCTGATGAGCCGCGTTCACGATATTGCTGTCT
TTTGGAGAGAAAATGGGAGTAAAAGTGCGATGGAGAATCAGGTTTGGCGGCTGCTGTTGGACATCATTCATCAGCTTTTAATTTGGAGAGGTGAACATCT
TGACGAGTTCGGGATAAAAGAAGCTCAGAATTTGTATTCCAGACTTACGAGTTTGGATATTGCATCGCACGCGCATCGTAAAGCTGTTACTGCTGGCC