Description :
From Genome Similarity Track
Location :
Scaffold_195:15572- 18257
Transcript NameFunction/comments
Albla_Nc14096120conserved hypothetical protein

Sequence
2685 bases(100 bases per row)
CATCGCCATCATAAAGGACATTGTTGGAATCCACACCATCAATTTTGTTCGTTAATTGCCGCTGTCCCCATAATCCAAACAATTGAGTGAAAAGCAGTTT
AAAGTGTACTCGCAAGACTTCGACCATGAATTTCGACTCAAAGCTCCACGCACGCGATTGGGTACGAGAACTTGCGTGCACATTTTTATCGTCTGATTCG
CTTTTGACACAATCCACTGGAAATATCCGATCAAAAAGGAGATTGTACATTGCAGAAACATAGTAGAACGGATCGTCGTCTTTGACAGACGGGGTGTACG
CTATGATGCTGACGAGACAACGCACGTAATGTAGAAAGCCACCATCCAAAAAAGCGTCGTGACTTTGAAAATAAGATCTACCTTGAAAAGCGTCATCCGA
AGCCACTGGGATTTTTACAAAATTCATCAAGTGTCTGTAATGTTCTTTGGCATCTTCCAAGAGCATAGAGACATTCGTCTCTGCAATTTGCCGAATGGCA
GATTTGAGAAACCCATCCAATTGAGACAAGCTATTCTGCCTTAACGCAACATTCGCCCCAAAAGTATACAATCCAAACTTGTAGATGTCTAGTTTCGGTT
CTAAGAACGTTGATATGGAAGGAATTGTGACAAACGCGTGAGCAAGACACGACTTTATAAATTCAGAGTCTTGTCTTCCAGCGAGCTTGGTGGTTATTTT
TTTCCTTTCCATGCTGCAAGGTCGAGCAACATGTGTCGTCAGAATAAGCACACATTTCGACAATGTCGCTTTCACAGGCTCCAACTTGTAAAATGCTCGA
CGGCAATCGGTGTAAAGCTGTAGCAATGCACCTTTCTCGTCAACAGTGACATTGTTCCGGGCTGAAGTATTACCACACAATGAGGTGTCGTTCAACACGC
CTAATCTCATTATAAACTTGCAAATATCTGTCGATGCTTCATAGAGTTGTGTCTGAGTGCTAAGATTATCGAGAGAATCGTGAATGCGGCAGCAAAGGAC
GAATAATGTGCGTGCAACTGCTGCCTGCGGGCCAGCTACATGAAGTCGAAATTGAGCTTTGTCTGAGCTGGGCTTCGTTAAGCTACTATTGCTGCCGACG
AATGCGTGCAATACTTTCTTGGATACACTGACGCTGGTGTCCTGCTTTAACAACCCTAATAAAGTCTATTTCACACTCAACGGTCAAATTCTTGTACGAG
AAAATAGCTCTGATACATCATACCAGAAACTCGAGCGATGGAATGACGACCACGAAATACTCCTTCTGCTTCCTCGCCTTGCAAACCACGTGCTCAATTA
TAGCACCCAGTTGATTGTAGAACGTGTCATTCAACTCCATCGGTGAAATTTTATCCAGCTTTCGGGATATATCTTTGAGTAGAATTTGTGCCTCTAAAGG
CTGGAAATCACACTCAGAAGTGTTAAAATAATGCGGAATTGACAATTATTACCGAAAAATGTGTGACAATTAGTTGCATGTACGCTGCTCCACATTCCAT
GTACTCTTCGATTTTGACAACCTCGCTAATTGATTTCCATGTCGTGTTTAAAAAGTATAACAAACACTTATGATCGATAAAATGTGGTTCCTTCTTTGCT
AATTGCTGCGCCACCATCGCATACAAATGGCTTTTGGTAAAGTTGGATTGGCTTGATGCACGGATGAGGTGACAGATCTCTCGACAAATTTTGTCGCTGG
CTATTTCCGCTCCAAACGCATCGATCAAATGCTTTAAAACCATTGAATTGCCGCAAGTTTCCTTGTATTGAGCCAATAAATCATCAAAAACGTTTTGGTC
ACGTGGTACCAAAGCTGCGTAGCGAAGAAGCCACTTTATCGCAGGTGAATGCAATGCCAACAGCTTCTCCTCGGTCCATGAATCAAAAGCCTTGGATTCG
GGATTCATGGTCGGGTGATGCTTTTCAGTCCACTTGCTAAGCTGATGTGTCCGAAAATGGCGGAGACTGATAAAGTAGTCGGACAAAGAAGCCATGATCA
CATTCTTCGTATACGCTCTCATCAAAGTTGAGGCGGATAATGTCAGATACAGGCGTGCGTATACTGCTACCAAAGGATCGGCAATGCCTCTGTAATAGTT
CCGAATGTTAGCAGTGCACAAAGCAGCATAATGTTAACTGAGGTACCTGATCATATTGGAAAGACGTAAAATAATGAGCTCAAACTCTCCATTCGACAGA
AACCGATAGCATTGGAGCAAAGCAACCTCGATGTAGCTTCAGAGAACGTAAGACAAGATAATAAGCAGATCAGAATCAGACACACTGACATGCGTGGTAA
GAGCTCTCGAATACATGCGGTCTTGTAAAACCAGTTACGGCATGTTTCTTTCGCTTGTACGTTGATTTGTGCGGAGGAGAAATCTTCCGGTAACGAGCTG
GAAGTCAAAGTTTGACCAAATTCATCACTGCATGCTCGCTCTCGAATACGATCAAAAACAAGCTGTCCAAACTTGTTTAAGATGGTGCTCACGAGTACAA
AAGCGCTTGGATACAACTCTGGACTGGTATCAGCATCTTTCAAAATCTTCACGGCCTTTATCGTTACTCGTAGGGCTTCTACCTTTTGCTTCCTTTGCCA
CGTTTGGACCAATTGTTCCTTCATTGTACTGATCTTTGCAATATATTCTGCTTGTGAGAGTTCTACGAGTTCATTTAACTCACTC