Description :
From Genome Similarity Track
Location :
Scaffold_2077:1557- 5149
Transcript NameFunction/comments
Phyta_totarag14081hypothetical protein

Sequence
3592 bases(100 bases per row)
ATCTGTCGTGTGCAGAACGAAAAGGTCCGACACCTTGCTAGGCGAGAATTGGTCTACTTCCCCTTTCAGAAAAGCTCGTATCTCGGTCAGGTGactgtct
tcttcttgatgcacCTTGATACGTCACCATCGCTCTGATTGTTATTCGAGCGGGTTCATTGGCACGCCATCCTGAACCACCCACGACTCTCCAAGAGCTA
AAGCCTTGTACGTCAAGTAGTCAACAGCTTGGTTGTAATCATGCTTGACATGTACCAGTTTGAGTGACTCGAACTTTATCTTTAGAACCTCGCACTCGGC
TAGACGTCTCTGCAAGTTCGGCTGGTTACAATTGATCAGACCTTGGCTGAATGACGATCCTCGAATCACCAACGGGTACCAGTGCCTTATTGTTCCGCTC
GGAGGCCATTGCCATCCCTTTCAGAAGTCCATGATACGCAGCATCATTTACAGTGACGTCTTCGAGAATATAACCGCGTGCGTCTAAAATGGACCACCCG
GGGAGCTGCCACAAATACAACCGCAACTTCCCTGCTGGGTCGACGTCATAGCAGCACCATCGAAACTGAGGGCAATACCATTGTAATCATCACTGAGCAT
TTCCACACTGACAACTGGCGGTGCCTTGACACGTCTCTTGGCTGGAATCAGTGATCCTGCAACCTCGTCTAGATGCTCACGTGGCGTGATACCAGCTAGT
CCATCCTCATCCCGTTGCACTTTTCGAACTTCAATGTCCCAGTGAGACAAAGCAACCCACGGTACACACCGGCCATCGGCCGTCTTCGAACGAAGGACCC
ACTTCAGAACCGAATATCGAGTATAAATCTCCAAGTGAGAGAGTTCAATCAATTGTCGAAAAACTTGAAACACTCGCAACATTGCGGTGACTTCCTTTTC
CGCAATATGGTAGTACAATTCAGCATCGTTCAGGACACGACCAGTGAAACGCACCGATCGGATTCTCCCGTCATAGACCTGTCCTAACACAGCACATGCT
GTCCATTGATTCGCGTGCGGAATAATGACGAAAGGTCGGCTCCGATCAGGATGATGTAGCAACGGCGTCGAAACAATCTTTCGCTTCAGGATCTCAAATG
ATTCTTTTGCTCTGTGCAAGTTCTGTCCGGAACGTACTTGTTCGTCCGTAAGCTCTCACTGAACGGCAACCACCACCGGAAAGTCTTCAATGAACTTATG
ATAGTAGTTCAGACTTCAGAGAAATGACTGGACATCTTTCAAAGTGTTCGGGAAAAGTAAGTCCTTCACACCTTTTGCGATCTTCGGCGTTGCGCGTATC
CCTTCTGCACTGATCTCATGTGCCAGGTACAGAATCACCAGTTTTCCGAACTCGCTTTTGGGCAAGCTCACTGATATACTCCAATGCCGAAGCCTGAACA
GGAGAGCATTCAGATCCTCGCACAGCTGATACCAGGCCTCGGCACCACGAACGATGTCATCAATATATGAGCTTCGTCCCATGACAGGGTCCATTTGAGA
AGATGTAGGGATGTTCCGCTTGAACACCATCATCCGGTCAGTCAGGATTGGAACAGACTGTTCAGATTTCCCACGCTTTGAGTCATTTCGTTCTGACGGA
TCCAGGCCTAAGTATTCCAGTACATACTGGTCCACTTTGGACTCTTCTTCAGAGGGTAGTCACACGAACCACATAAGCAGTTGTTGATCATGGCTTGATA
AACTAAAGGAGCGTTCTTGAGTCCGAACGGCATACGTATTCATTAGAAATGTCCGAATGGGCAGGTGAAAGCTGAAACCAGCTTCGCCCACTCAGACATC
ATAACCGCCCAGAAGCCGCTTGCCATGTCGAGACTCATGAACCACATTGCTCGTTCGAAACCAAGCAGGAGGTCATCGATCAGAGGCAGCGGATAGTTCG
ATAGCTCGCTGAAGCCATTCACGACTCTGTAATCAATACACATTCGGATGTCCACATCATTCTTCTTcaggacgatgacgattGGGGAAACCCATCGTGA
GCTGGAATGTTCTATCAGACCAGTCTCCAAACGTTTCTTCAGCAATTCGTACACCTTCATCGCTAGGTGCGGTGCGATCGAACGGGGACGTTGTGCAACC
GGTTTCGCGTTACCTACATCCAAATCACATATTACCCCTCGAGCTGGTGCCGGAGCTGCATTTCCATCTCCTAAGAAAATGGATCGACGATACTTCAGTA
TGGACTTCAGTTTTCGAACTTCGTCAGGAGATGATTTTCCCGGTACACTCACATCTGCCTTGTCGATGTCACAGGTCGGACTCAGATCCTGTAGTTCCGG
TAACATGGCCAACTGATCACGTAATTGAGACATCAGCTCACTGCCTCATGGATGTACACCGCTGGTTCCAATCCAACTCCTCAGCACTCACGTTCATACA
TCTGTCATACTCCAATTCAAGCTTTCGGACAGGCGTCCCAGTTATCGCCCGAACGGAAAGATCTGAcaggtcttcttcgtcaaacGTGTTAGACACAGTT
ATCAGACCATCTTCGTCGAGACTGATTGAATCAAATAATTCATCTTCGTCCGAATCGGCATCCTCGAGCGGACCCTCTCCAGTCTGCGACCAATCATCAC
ATCGTTGAAGGTCGCCTTCATCCATGTTCGGACTCGTGACGATAAGTTCTTCCGGAatgtcttcaccttcaacgTCTCCTGCTAGAAACGTGTCTGTACG
GACCTCCTCCTCGGGAGCAGCTTTGTTCACAACAATTCCATCCTGATTACTTTCACTCGATCCGACTGTGTCTTTGGTCGGTACATCCCTGCTCGACTCC
TGCGATGTAGCATTCGCCAACACGTGAGGCCTTTTCTGCAATTGCATCATGTGGACTTCATTAGTTCCGGGTGGAGGTCTTGTTAACCGTTTGCTCGGCC
AGGGGTACACGGGCGTTTGGATACAGGGTGATTCGGCGTCATCCAAATTCTGTTCGATCTGTATCGCACGTTGTCTGACTCGAGTCGAGTTGGTGTTCTC
GTAGATGAGTGTTTGCCACTCTTGATACCTTTGAAGACCCGGACGTATAACTCTCCCGGCCTTCGGGAAGTATCCGAACTCGATGATCTTGGCGACTTCC
GTTCGAGTATCAATGGATAGAACTCTGGTCAAAATATTCACCACCTTCACTGCGACCGGCCAGGATCTCGCGCCATAAATGATCTGTGTCACCCACCGGT
CTCCTCGGCCAGCCCACACGACTACACGCTGAGGGTTGCTCTGTCCATACCGAATTCGCACAATTTGCATGGTCGCCTGTACGGAGgttgtaacggggcg
ttccccgttacaaaagtaggtagagtcacatctccttgaagagggatgtgacgcggCATTCTGTGgttggacagaatgtccatttaggttaggtctttga
ccagttagcgtgcagcacccagaccggNTCTGGGCTTAAGTTCGatttcgcgaccgaacttaacatcaaacagagttaattttcCTTCTAAaccacgtgt
ctcggttatgaaacccgagacagcgcttcctcaatcaacagtGGAAGCCAACGTAACGGTCTCTCTGGCCCCGTTGCAGAGGTATAAttcct