Description :
From Genome Similarity Track
Location :
contig_66:155668- 157167
Transcript NameFunction/comments
g11839.t1hypothetical protein

Sequence
1499 bases(100 bases per row)
ACTTGGCGGTCACTGCCATCTCTTCGATGGCGGTGTTTATGTATCACTTAATGTGTGGACAGCACCCCCAAAGCACGGGATTGTTTTTCAGTACTTACTT
GGAGCCAATGTTGAAGTTGACGTTACCAGGGATTGATGCGAATGATGAGAAGAAAACACAAGCGACAGTTCAGCTGTATTTTCACATACTTTCGTGGCTG
CCCCTAGTGAATGATCCGGCTAAGGGTAATTTCCAGGCAACGAAGCAGCGAGGGGAGCTGTCAAACCAATTGTTTGCAGACATGAAAAGCAGTTTGTTTG
CTGAAATCTGTTCTCTGGGCAGTCAAATTGACGAAAAAATGTGGGAAACTGGACCGTTCTTAGAGGAATGGACGTTTGCAGTGTTGGATCGTTGCTTTCA
ATTCATTCAGTCGCGTTCGGGTGCTAGGTCTGCCTCGCCCAATGCTGACAGAAGCGGGAAATCTTCCAAAAGAGATGGAAGTGAAGACGCGATCGTATTG
CAGGTTTTGAACCTATTGGCCATTTTGTATGTACAAATGTCCCCAGAAATCTACACGCAGTGCCTGCGCAAGACTGTGGCTTTTGTGTCAAGTGCGTTCT
ACACTACAGCATTTGGAGGAAAGGTAATATCGACGTTGATCTTCAATTGCATGCAAGGAAATCCTTCCGAAGCCATCGCGCGGTTCATGCCGCTTGTTCT
GGAGAATTTTCACGCTACGAAAACCAGCATTGATGTGGTCGGCTTGATGACGAACGAAAAAGTGTGGTACTTGCAGATTCTCAACGGCTTAGTGCGCTTT
AGCCACCAAGATGATCGCATTCTACTGCGCTACCAGCCCGAACTGAAATTGATTCTGGCACAGTTTTTGAGCAGTGACGATGTCAAGGACGTCTACGAAG
CTGCTGGTGCTGTATTACGGCATTTGCTCTCGGGTCTTGTAGGAGTTTACACGCACGACTTTCGCTCGTTACCTGCTGCCGAGTGGGTGGATGCAACATC
TCCTAACAGCGGAGCTTTCCAGTACATGGGCATTGGAATTTCGCAGAACAAACTTTCGGTGAAATGGCACGAACCGAACGAAGCAGAGCTTTCGTTCGGA
TTTAACCTGCTGCAAGATCACGTAGTTGGAGCACTCGATGAGTTGGAACGCATGAGACAAGCCAAAAACCTAAATGCTCGTACGTGGACGCGCCTTCTAA
ATCAAGTGTTTCAGGGTCTTTGTGGGGCTGCAAACGTGCTGACTGATGACAGTGTCACGGAGGAAGGTGCGCTCTTGAGTGGTGCAAAGCTACTACTACT
GAAGGCACTTGAGAGTAATAGGGATCTTTTCAAACAAATTGCGTCATTGAAAAGCTCCCTGATGAGCCGCGTTCACGATATTGCTGTCTTTTGGAGAGAA
AATGGGAGTAAAAGTGCGATGGAGAATCAGGTTTGGCGGCTGCTGTTGGACATCATTCATCAGCTTTTAATTTGGAGAGGTGAACATCTTGACGAGTTC