Description :
From Genome Similarity Track
Location :
Scaffold_652:15565- 17057
Sequence
1492 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGAAGATTCGTCTCCAGTAGCCCAAAAAGGTAGGTAGGCTGGTTTTtACCCTCACCGAGTGTTTGTACTTCGGGGAGTTTTtCCCAGC
AGTAGATAGAAGTTGGTTGTAAGGCGTTGGGCGACGCGCTGAGGGGGAGTGAGACGACTCTGTGCCTGTTgTACCCCTGGGtGTCACGAGCGCCCAGCAG
GGGCCATGACACCCGAGGTGTCAGCGACGGGTGTCGCTGGCGGCCTGTGATTGGCTGGGAGGTTGAAGCCGCAGCTTCAACACCCCTGGGCCACGAGTCA
CATGTCACTGGACACAAGACCACCCTGATTGGTTAGAATCGATCGGGGTGGATCCTGATTGGCCAGAGATAGTCTAAGGTTTtGGGGTTAAACTGATGGA
TGGCCAAGGGCCGTTGGACACAGAGGgAAGGGGACAAAGGACACGGGACAGCGCTGCCCATGCAACTACAAAATAGATACTCACTTGGATTTTTCCCTAC
TAGCCAACAAGCCATCTCAAGCCATCTCACGTTATCAGCACTGCTGGCTCCCGTCCGAGCCTTCGACAACTGCGCCAGCCGAAGATCTGCTCTCGTGCTC
TCGTGATCTCGTTGCTCGCCACTCGCTTGCTGCTGCCGCTACGCCGCTCGCTGCATCTCCTCACAGATGACAtCGtGGCTGCCTCGATTCAA