Description :
From Genome Similarity Track
Location :
Scaffold_77:15564- 22366
Sequence
6802 bases(100 bases per row)
CCTATCCCCGACTCGGTCAAGACAGACATCGACCTCAACTCGCCTAGAAGAGTGCAACCCGCCTTACGACGGGTATACAAGGTGAGAAGGAACAAGAAAA
GACATACAGTCCGGAGTACCCCCTCCGTTAGTCGGTTGTCTAGGCGCCAGTAAAGAGTTGGGATCGCTTCAGAAAATGAGCGAATACCACTCCACCACAA
TGGTGCGCGTGCCCGAATCTTCTGGTGACTCGGTATTTCACCGTGAATACCGGAGCGAAGATGTCAAGATCAAGGTTGAACCGGGGATAGTAGTGTCGGC
GAAGAAAGGATTGTGGTAGACACGTGATCATCAACCGCCGGAAGGAACACGTCCAGCCAAAGCACGACATGTTTGATCAAACGCCAAAAATATATACAAA
GAAAAAAGATCGAAGGCTGCGGCTCAGAAGTTTTGAGTGCCTGAATCTGAAGGCGACAATCAGGAAACGAGTGAGGCAAAAGAGGTTAAGACGGAAGGCT
GTAAGATTGATCAGTTACAGCGGCGTTTGCACTGTACCCAGCTTCAAACCTTGCTATTCACAGATCCGATGCTAACGATTTTGGAACCAGAACTAATCGG
ACCGATCCGAGGTCCTGCGATGGAACGACGAGCCGCTACAAGCAAGATGGAAGCTATACAACGTCTCATTCAGTTGGTACAAGGCGCAGGATTTGTACCG
GGGGCGTTCGATGCGCAGGTTTTGATGGACTGCGACCTGGATCAGGTGACCACGGCCAGTAGATCACTCTTTAAATCGCTGGTCCCACTTACCGGTAATT
AAGACTCGGCTGATTGACACTCACGACCACTGTCAAGGTCGAAGAGGAAGAAAATTCTCCGGCTGTGTCGTCGCACCATACCTCTGCGGAGTCGGATGCA
GAGGAAAGAAATGACATGGAGATCATACGAATGTCGTTGGGAACTTCCGGAGCATCAAGTTTGCGTGACCACCACGATAATACCGCTCCAAACACCATGG
CGAAGGGCTCAACCACCACGCAAGTCCCTGCTATGATCCGACCAGATGCAAATAGACTTTGCAAAAGTTATGGAAAAGTGCTTACAGGACCAACACCGTC
GACCGCTCCGTACGGCGCCGACCGGTCGTCCCTCCCCCAACCATAATGTGTTCGGGGCGTGTATGCCAAACACCGACATGGAATCAGCTGACTCGCACGA
CAGCCGCGGCAACGCTTTCGACCCTGACGATCTCGATATAAACGACGTCCCCAGTTGGCTACTATAGAGACCATAACAGGACGAGGTTTTGCCGCACAAC
GAATTCGCATGTCTGCGATTGACGAGTTAAAAGAACTTTCGGGGCGCGATCACGATGATGACTGCGCTAGAAGATAGTTACGCAAAGTCAGGTCAGATTT
CCTTCGTGACCAATCCCCTGACTCGGAGAAGTGTCTGGTTTTTGGTGATCTGCTAACGGGCCCACTGGTACTCCCAATTGAGTCGATCGACACGCAATAA
GTAGAAGGACTTGCTCGAGGGCTTCCTCTTATAATACTGTGGAAGCGGCGTCTCCGCTGGTCGCCAGTATTACCACGCCTGCAAGCGTGTCTATGAGACT
CCGTTAGAATATCTTTATCGATTGAACGTTGCTGGAATGCGAGCGAAAATTCATTTGAAAGATGGCAATATCACTGATCGTCGTGACCATGTGGAACATT
ATACATAAACACTGGACGATCAAGACCTTGCGAAACAATTAACGCTGCTGCGATTAGACGACGTGGATATACTGGAGGAAATGCTCCACACGTATGAACG
TATGCAGAAACGTAAATGCAACCTTTCGACCAGTTCAAGCAAGTTCAGCTCACGATCAGCTTCACCATACACCCCAAGTCCATCTAAACCGGCCCGAGCC
GTGCACGCAATCCACGTGGGGGTGATAGCAGTTCTTCAGAATCAGATACAAGCGGTTCCGACTCAGAAGAAGAGCAACGGCGTGTTTACAGCGCTACGGC
AGCCGATCAAATGACAAATCGAACGAATGAACGTCTGACCAAGCCAAGATTGGGTGATCGTGAGCGTGATCAAGATCTTTCAGGAGGACACAAGTCGTGC
ACTTATGGTGGGTGGAAAAACACATTATGATCGTGGATGCTGGAACCGATTGACGTGACAGAAGTGCGGACGCCGAGGTCACCCCTTGGATAAGTGTTTA
TACGGGTGCGCAACGTGTGGAGAAGTACACGGAGGAGGCATATGCCCGATGGAAAATTTTTACAACATGCTCCACAAGTGGTATGTGCCGAACAAACGCG
CTGGAATGCTTTATCCTGACGCTGAAAAGATGGTAAACTTGGACGCTCACCAGGTTGGAACCTGGTACGAGGCGAGCGTTCTAGGCTATGCATATATGCA
TTCATTGAAAGAGAAGGGGTTGATAACAGTGTTAATCGCCTGACCGGCTGGACTTTCAGTACATGTGATTTGGATTCTAGTTGTTTACCTTCAATTTCAA
GTCCGCGACGAACGGACGAATACGCACGATCACCCACTAAGATGGAACTCAAGTTGTGTCCTGGCGAACCACGTAGTTACTGGAAGTATCATAATTCAAA
CAAGTGGTTCAGGCAGGCCAAGGCAGGTGGAAAATCAATAATGAGAAGGTCCTCCTGCTGGTTGACTCGGGAGCCGAAGTCTCGATCATCGACACCACCT
TTGCTCGTAATGTTGGCTGTCTCATATATGAGAGTCAGACGCAAGAATGTGTGGGTATTGGAAAATTTCTTACATGTCCGAAGGCCGCACGAAGGTGAAG
ATCACGCTGAATGGATAACTAGCCTTTTACCATTAATGTATGGGTTGATGACCAAGTGGGACAAGAAGCGATTCTAGGGAATATATTTTATGGTACCGGC
CGGGATACGCCTTGACCTGGCGGACGGAACAGTTTCTTTGCCGGACGAAGTCAGAATTCAACTGGAAGGTAGGAGACCACCGTATGGGAAGAAGATACAA
CGAATTGACGCGAACAAGAAGTACTTGGCGATCCTGGTAGGTAACTCCGTAGAAGTCAACGTTGGCCCAGGCCACTGCAGTCAAAATTGTGGTTAACACG
CCACTCACACTGAGCACTTACGGCTACGACTGGACCTGGAAGGTTGACTTACCTTCGCTTGTCCAATCTGACTGAATCAAGAGGTGATCATTCAACAAGG
GACACCATTCGGGCAATGAATGCCGGCGGATATGATAACACGATCACACGGGTATGTGTCAGGAGGGTCACAGAGATATCAGGAGTGGCAGACACTTGTG
TTTGAAGCAACCACGGAAGAAGAAGAATTTCCTGAGGTAGATGGGCCTCTGGTTGATCACCCGTAATATTCGATGCCAACGCGCATTCTAAAACGACCGC
CGAAGGATATAGCGGGGACGAACGTGGAAGAATAGGAAGCAAAGTTGAAAGGTGATATGCTGATGTGTGATCACGTGGACAAACAAGATAACCTTGAAGT
ACCACAATCAAGACAGTTGCCAGTGGTTATTAACGCGATCATCACTCCTGGTAGGACTAGGGACGGGGATGACGGTGATGTGGTTTGGATCCGGTGTCCG
ATCATCTGGGGCAAAATAGTGATCCAAGAGAGGAATATCGATGCGATTGCCAGTGATAGTCGACATGAACACCCCCATTGACGTGATTAAAGACATCAAT
ATTGTGCGGTAACAGTCAGAAATACAGCCGAACGATTGTAAGGGAGAACTCGCTCCTGAACCGATCAATGAGTTGGTACCTGATCGTGTGCAAGACCGGT
CCACCAATCACCCAGACGTAATCACTGGTACGGAGTTTGAGGCACATTGACCGTCCGACCGTCAGGCGAACCAAGAAACACCAATTACAAGCTAAGGAGC
ACACGATTGCTCGTCATACTATTACGAAAGTGGGGTGATTTTGCGGGGGATGTAGACCAACACATGGCAATCTTACCAAAAGTAGACGTGATGCTGAGAG
AGGTGAAAATTGGCTATATACAGGTGGGCGATGCAGGAGTCTTATTGACCAAGGAGCAAGAGGAATTACTTCAGCTGATCTGGAAGAAACGACACCTTCT
GATGGGTAAAGGAAACGCCCCCTGCCTGCTGTGCGAGGTGTAATCTGTAATGTAGATGTCGGAGAAGCAGCCCAATCGCACAACGAGTTAGTCTAGTCGC
CCCAAAGTTCCGTGCAAAGTTGGCGGAACTGATCAAAGGGTTACTATCGGCCAAAATTATAGTTCCCTCAACTTCGCCTTGGGCGTCGCCGATCGTAGTG
ATCGTGAAAAATAATGGGGTGGACATAAGACTGTGCAGACTACCGACTAGTGAACCAATTGACGAGGCTGGTGATATATTCCATGTCCCTGAGAAACGAC
TTGTTACGGATTTTGGACAAAGCGCTATGGTGCTGTTCATTGGATATAGCCAGCGGATTCTGGGTTGTGAAGATGACGGAAAGAGCACGAATGATCTCTG
CTATTATTACTTCCTCAGGTCTGTATGAATAATTACGCATGCCGTTCGGGTTGAGGAACGATCTGCTGATATATCAACATCTGGTGGATAATGCGTTATA
TGGATATCTTATGATCGGGGATCGGCGGAAGTCAAGTGACCACGGGGTGTCTCAACAGTTCGATGTGTTTACAGACGGCGAGCCAAACCCGCACCGAAAT
CTTTCGATATTAGGACGGAGGTCCTACATTGATGAAATTCTAATCCCAGCGTCATCTTGGACGTCTCTCTATCAAAAGGTGGAAAGATTGTTGGAAGCAT
GTGATCAGTGGAATTTGTCGACCAGCCTACCTAATAGTGAATGGGGACGAAACAAGGTTGATTACCTCGGGCACCAAGTGTCGATAAAAGGAATCGAAGC
TGACCCGAAGTATCTGGAGTCGTTGGTGAATACTCCTTTTCCCCAGACATGGCGGTCAATGCAGTCCTTCCTAGGAAGCCCGAACTATAACAGCTGGTTC
ATTGAAGACTTTTTCATTACGCCTCCATCTTGTACGAATCAAGGGAAGATGATTTTCATGAGATCAGGAGTTTGCACAACACGGAGAAATGTAGGCTCAT
CCAGCTATTATCACGTCCTTATTACCCAGATTGATGATGGCCTCGGGCAGCAACCTGCTGGTGATCACGATTATCAGCTGGTGAAAATGAATGGGGAGGA
TCAAATTAAAGTAAAGGAGTCCGACGTAGAACATACTAATACTCATCGTTGGGAGAAGGCCATGATTGCGTTTACTAAGTTGAAGGCTTAAGTAGCCCAA
CCCCGGTGCTCAGACATTTTGATCCAGACCGCTGACCAGTGATCGTGGTTTATGCTAGCAAATGGGCGGTGTCGGCAGCTTTGCTACAAGAACATGATGG
AGTGAATTGGCGTGTTATATTCACAAGTCGAACGTGAAAACCCAATGAAATCAATTATGGAGCGGTAGAGAAGGAAGTTCTGGCCCTGCTCCGGATGTTG
GATGTTTGCTATACGCTATTGGTCTTACGGGATGTTAAGGTACTCACGGTATACTCTACCTTGGCATGGTTTATGTAGTCGTCAGGTCCAAATGGATGAC
TTGGAAGATGGGCAGCTTTACAGTCGACTTGGACATTGCATATTGTTCGGTGCAACAGAGGGGAGGACGAAATTCTCGGCACCCTCGCAGCGAGTATTAC
ACCGCAAGAGGATATGGATGAAATGTTGATCGCGATTGCACCACAGAAGAATCCGAGACAGACCATCATTATACCAACCCCTACGGTCAGACATGGCGAA
GTACTTCTGGTCGTCACCTTTGACGGGTTAGCACGTATTAAGAAAAAAGGAGGCGCCTACAGTCCAGAAATTTGTGAATAGCCCGGGTGGACAATACTGT
CGGCTGCGTCGCGTTTTGATACTGGATTAACAGTGAACGAGGCAGAATATCACGGGTTACTGCTAAGCTGCGAGCTGCTAGCGAAACAAATAAGGGGGCG
AGTTATCATCTGTGGTGATTCCAACCTGGTCATCTGGCAGATACGAGGTGAGGTCGATTTCAAGGCACCAGGGCTACAATTACTGCATCTCAAAGCCCTA
GATCCACATAGGTCGTGGCCGACACATGAGTTCTTACACATTAGGCGCGCTCGAAATCAAAGTGCGGATCGACTGGCTCGAACCGCTTTAAAGCTGGAAA
AGGGCATGTTTATGCTAACTGATCAGGATTACCACAATCTAAGCACCATTAACCGACTGGACGAAATATTGACGCCAGCGTGCAATGGTGAATTGATCAA
GATGACGGCGATTACAGGATTGACTATGCGAAGTCGTGAGGCATTCCATAATACAAGAAGACGTAGTACAGCAGATGAGACTTGACCGTATAAAACAGGC
GCAAGACGAATAAAGTTGGATTGCTAACCTCAAACTTATTTGGAGATGTAACTGAGCTGGGTGCTGTAGAAGAAAAAGTAAGTGCCGTGATTGCCCCAGA
CTACGTGGTAGGTGAATGCGGATTGTTGTATTTTTGCCAGCGATCGGCGACAAATCCCGACGATCGTGCTGAGCTCGTTCGTTTGATGATCCCGGAGCTG
CTCCAAGAAATTATTCTACACCATTACCACACAATTCTGGAAGGTGGTAATCAAGGGGTGGACCGCGCGTATCACCGCGTGCGATCAATCTTCCATTAAG
GAGGTTTGTTCCGAAGCGTGCTAAAGTATGTGGGGAATTATTTCAACTGCGAAGCCGGGAAGGGATGTCCGGTGCTACGTGGAGAATCCCCGGGAAACAT
GC