Description :
From Genome Similarity Track
Location :
Scaffold_93:15563- 20643
Transcript NameFunction/comments
Hyaar_Emoy2809024hypothetical protein
Hyaar_Emoy2809025hypothetical protein

Sequence
5080 bases(100 bases per row)
AGTAGGTGCCCGTTGCAAACAGGTGGGATCGGAAGAACTGCTCGTGCGGGTCCAACTGACGGAGCTTTGCGAGCACAGGCGCAACAGTCTGGACCACGCT
CAGCTCACGGAACGTGAAGATAAAGGTGAAACGCTGACTCCAAGAGACCCTATTGCAGGACAGCTTGGCAGCAAGTTCATCCAGAATGGCCAGGACAGGA
GTCACGCCGATACCTCCGCCGACTAAACAGACGGTGGAGTAGTCTTCGTACAGTTCAAGCGAGGCGCCATAGAAACCGTCCATGTACATTAGCGGCGCGA
TGTTGTCATGGTGGCAGACCAAGGCGTACTGCACCAATGTCTTTGACCAGTCTCCAAGAGGCTTGACCAACAAAACGACGTCGGTGGCGCTCGACTTTGG
AGAAGACGCAATGGTGAACGCGTGCCACTGGAGCTTCGAGATATAAGGTACATTCAAGTAGACAAAATTGCCGGCCTTGTAGTCATACGACGACGACGAG
GGGGATGTTCCTGGTGCAGCACGCTTCACGACGATCTTGACCAGCTCATCGTCACCATCGCCAATGACCAGAAACTCCTTTACTGAGACGGGAGTCATAG
CATTCCAACTGGAAACAGTCCGACTAACAAACCACACGCACCCTGACGGCAGAATCCACCAGATGATCTGAGCCCAGTGCAGGATTGCAAAGAACACGGC
GATAACGAACAGCACCCAGTGCGAGATGTAGAACCACTCGTAGGCTTTACGGCGGATAATGGGAAACGAGGTCGGGATCATGAGCACGAGTGCGAGCGTG
GACACGAAGCCAAAGACGTTGAACCAGGCGTAATAGCCGCCTCCCGAATTGTCCAGCGCAAAGTCGCAGTTAATGCACGGTAGCTGGTTGACCTGCCACT
GGCCCTTTCGGACCCAGCTGCCCCAGTACCCAGCCGTGTGCACGACAGCCGTAAGAACCGTCATGAATCCTATCCAGCGGTGGAACTTGACCCCATTGGC
GTACGAGATGTTGAAAAACTCCATCCAGCCACAATTTCTCGTGACAGGCAGGAGGAGGAACGCCATGTTATAAATACACAAGTACGAGGAGCTGATACCA
ACGATGTTCCAGTACTTGGTCGTGTCCAGAGTGCCGGCCTCCGTAGCCATGTCAATGCGGCGGTCCCACTGAAAGTACCAGCAAAGGCCATTGCCACCGA
GCACGTAGACAACTCCAAAAATCCACTCACCCACCGAGAACCGCGATACACTGAGTACCGGGAACTTTGGCTTACGACGCATGAGCATGGCGAAGCGCCA
GATCAACGTCGACGTCAGGCGTCGAGCTGTATTGATGTGGCGCAAGTACTCAATGAGCAGGACACTGACAATAAAAGGAAAGATGCAGAAGATGAAGAGG
AACGTCGGACGAATCATCTCCGTGTGACCCGTCTCCGTGATGTTCCGTCCGACGCCCGTGTCCAAGAGAGCGTGGCTGTGGCTGCCCATGTCGGGCATGT
TCGGGTACCCGTTCCACCAGTCTTGCATCGTGTTCAACAACTGGAGCTCATAGATTGGTGCCCACGTCGCAATGTTTCCGAAGATAAACACAGCGATGCC
CAGCGCAATGAAGAAGCGAACGACATGAATGGCAACGGACGGTGTGGCCTCGTGAGTCAAAAACTGACTTCCTGGGCTGCCGCCTATGTCGATGACCGGC
GTCTTGAGTGCTGTGTAATCTGCCATGGCAGTTGCAGCGGTGATGGGGTGGTAAGAAAAAGGATGCAAGGGAGTAAGGAAGCGGTAAGAAGAGCAGTGCG
GGAAGTGACGTCAATCGGCGAATGGACAGAGATGAAGGATGTACTTGCCTTTTCTCCACGTTATAGTTGACGGTCCCTCTATTAAGTCGCATGCGTCTAC
TTATTCGCATCTGCTGCAATTGTTGAATCGATTCGAGATCACCAGCTGGTTTTGCGGAGCTGGCAGTTGAGCTGAGAGTCAACATATAAGCTGAAGTTAG
AGACTGGGTGCTGTAAGGGGAAGTTTACAGGTTGTCCAAATGAGACCAAACGGTCCAGCACTTACCATCCAAACAACGTGGACGTTGTCAACAATATTCT
GTGTCAGGGTGCGTACCGCTGCGTATGACACAACTGCACGAGACGTGTTTGGCGCTACCTACCCTACCCTGAGCCAGAGTAAATATACTACTTCGGGTGC
TCTTGAGATTGTGAAGAGGCAGATGAGACCGTCGCCATTGCTCGCATTCAAAAATTGAATGGTTGCGACCCCGCGTAGCTGCAGCGAACCCTCACCAGGA
GACAAGAGCGCACGCATTTTTGTACGGTGGATCAGGTGAGACTTGCATTTATTTTTGGGGTTTTTTGAAAGATGTGATACAAAAACGAAAACTTTGCAAG
ATGTGATACAAGGTATTTTATAAAAGGAAATATATTTAAATTACAACGATCGAAATGATAGCTATGTTAAGGCCTAATTTACTGTATGTTTAATCAAGTA
TTGGCGGGGCACAACTCGCTATTCGCATCTGATTCCGCACGAGAAGACGGGGGAGGCGCTTACTGCTGCAGAATACACTGAGAGTTCATTAGCGGGTTAG
AAGTGACGTATGGAAACGCACTAGCAGCGGGCGGAGGCTTTCACCGCGTCACGACCTCTGAGGGTGTGGCAGCTGAGGTGTCGCCCTACACGTATCTCTA
ATACAAACTCTCATCGCCGACTCCGAAGACGGCATATTCTAAGTCTGATTCTGATTCTGAGTCCTCGCGCGCGATCACGCAGCTTTGTATTGGCAACGAA
CAAGAGGGCGAGTGGATCAAGTTGGACGATCGATCGACCGAATGGACGCTTTCTATGGTTTCAAGTGACACAATTTAAGGCCCGACGTCGCCATCAGCAC
ATAATAAACAGCAGCTTATGCTATTGAAAGAGATCTGCGTCGTACGGGATGTGAAGGACCTTCCGGAAGGCTTTGAGGCGCTCAATGAGCGCTGAGGACG
GCTGCATATGTGACTAGAAGAGCTGCGGACGTATTTATGTGTCCGCCGACTTGCAAGTAAGACTTTCCCGACTCGAAGTGGTCGAATATGAATCAAAAGT
AGGTGACTGGATCGATGTCAAGTACCTGTCGTCCAAAAAGTGGAGTGTGACGCAGATTATGCACCAAAACGCGTCCGAAATCCGTGTGCATATTCCGACG
TGGCGCAAGGGATATGACGATTTTCTGTCGCGTTTAACATGTGGAAACCGCTTTGATAAGCTCGGCAAACATACGAACGTGTACGTGTCGCCGGCGTACC
TGTTCTTACGCAAGAAAGCAAGTCTGTGGGATACCAATATGAAGGACTTGGAACTCGCCCGAAGACAGTTTGACAAGTACTTTTACGACCGTGACAAGCA
ACAGGCGTATCTGCCGCGATTGCTTGTGCCGTTTATTAAGAAGTCGTTGCCGCATTTACTTCTTCTCGGCGCCTTAAACTACTTTAATATATGCAAAGTA
CGGGGTATCTTTAAGTATGAATTCAACTACATTCATCGTAAACCATAACCTTGCGTTACGATGATCCATCTCGGTAGTCTAACGTCAATAACAGCGGTAT
GTAGCCTTGTTGTGTCCCGATGTACCACACCGCTTACATTTGTAAGGCTCCCTTGCTTTCCCTGCTAGACTCACCCTGTGATCTGATACGTCTTTTCTTC
GGGCGTCCGGCTTGTCGAATATAAACTGCGGGAAGGATATTTAAATCACGTTTTAACACGTGGTCCTCAGCAACCTCAAGCGTACCGACGCTCGCTTGAT
ACGCCGCAACTTTGTAACAGTTACCCATCAGCTTGTACGCAATATTAGGCGTATCTACCGCTCTTAAGGTCACGATCAAATGGCGGCACGAATTTTTGTG
CTGCTTCCATGTTTCACATGAGCATGATGCTTTCTTTGCGTCGACACGGTGTTGCTTCAGTTGATTGCTGAATCGAGCGACGAATGATACGTTATCAGAA
CTGAACGTCACACCATATCCTGCAGCATCCATGACCTGTTTCTGCAACTTTTGTTCGGCCCGAGGCGTAACTGTACGTCCCTCTTTCCTCCATAGCATGC
CCAATTAAAACCGTCTGTAACACTCATCCATCATATTCGTCGTATAAGCCTTGAAGAACTCGTACGGCATCATAAGCCGTGGCTTCAAGCGGAGACTCTT
TTCTTGCTCACTCTTAACAAAGTTGGTCGTTCGCCATCCGTAAAAAGGAGTTGCGTCGTAGTGTACGTGAAGTTTCCACTTATGAAGTGGTATTGCATTT
TAATATATAGCAGCAGCTGGGTTGATCGTGTATAGTTTGGTCATCGCGATATCGAAATCTGATCGAGGTGATGCAGCATTCGCTTCCCATACGAACTTCT
CTTGGGTGACCAATAGTCGTACCATTTTGTCATTTCTCATATTACCTGTGCAGAAATATAAGACAAGTTAGAACGAAACTGCTGATAATTTGGCTGTTTC
CGTACCTATAATGTGAAGAATGCAGAACATGTCAAATATGCTGAGCTTTTCGGCGGCAGATACCAGGCCAGCATTTCGATCACTGAAGATGAGACTAGTA
GTCAGTGGAAACCATGATTTAGAACACGGCAAAAACCCACGAGTAATTATCGTAGTCTTCAACAGGGACGAGCGCAATTGCAGCAATTTTGTTACTAAAA
TTTCCGTCGCGACTGGCCAATACAATCTGAACCCTGTTGTATTTGCGATGTTTCATGTGAGCACCATCAACACCAAAAATCCCTTGGTCATTTGAAAACC
ACTTCGGGTTTAGCACAACGATTGCCCGCTGGAAGTGCCCCTTCTCGTCGCACTGGAGCTCCGTAAGTGTTCCTGGGTTCAGACGCTGAAATTCCGACAG
TAGACTTGGTAAAAGAGTAATCTTCGTTGAATCTTTTGAAAACAGCTCTTCATTTATTTTTCCTTGGCAAGATACATCACATGATTGGACGCAGTCATCT
TGGATTGGTGACGAAGTTGACCTACTAAAATGCTTTCGGACGTGGTCGGTTCTGCAGACAATGCACCACAGACTATAGAG