Description :
From Genome Similarity Track
Location :
Scaffold_397:155620- 156938
Sequence
1318 bases(100 bases per row)
GTCGAGGGAAGCGCGTATCGTAGAAATACCAGCGAGGACCACGAAACAGTCGTCGTCCTTCGTTAGCACATGAACGTACACCACTGGGATGATTCGACCA
CAAGTCAGGGACTTCATGGCGATGGGATGCACTCCAGGCCGTGGTATCGCGCAAAGGATGCACACTCGACGGCTTTTCACAACAGCCGTTTGTGTCACGG
CATTGCACCCATCCACCGTGCGCCGCCGTGCCTGGAGCATATTCCACAACACATTGCGAACAACATGCAGTTGGGCTCAATGCAGCACACGTGTTTGATT
CGCGATCGCTTGGGTTGGCGTCGAAGCGGCTGCAGGGAGTGCGACGTTCCTCGTTGAGCTCACAAGGGTCTGCAAGAGCCTGTCTCGCGCATGGCATCTC
CATCGTCTTTGCCAAGCGGGTGCAGCCGTGGACGCGGCACGAACGCGGACGGTAGAGTCGTCGCTGAGTTGACCTGGCCGATCGAAACCTCACACATGAC
GTGAACGGTTGGTTGCATGAGCCAGGACAATCTCGAGTAACTGGCCCATTCCTGTTGAGGTTCGTCATGTCGCTGAGGCTGCCTACGCAAACTTGCAAAA
CGACGGACCCCATCGCGAGGACGGGATGCCATGGCATCGCGTAGGTTTTCACTGCTTCCACGAATGGACTTTGCGATGTCGAAGCATCGATCGCCGCCGC
GCTGCCATGTCCCGTGCGGCTTCGGAACGAAACCAACTGGTCGCGACAATAATGTCGTCCCGCTCCAGGGTCGTCAGAAGTCACTGCCGTTTGAACGAGA
CGAAGAAGATTCGCACGGGCTATCACTCGGTGGGGCTCAGTGGCGTGCCTCTGCGCTGTAGTGGAGTTGGCCTAACGAGCAAATTCAAGTTGCCTCGTGC
GGCGCGAGCAACCACGTCAAGTCCGTGTGGTTGTCGGCGAGGGGGGGCCCGTGGTGAAACGAACGCGGAACCAAACGAAGCCGCCGAGGAATTCGAAGCA
CTCTGTGCTCACCGAGTCCCTAGGTGAGAGCATGTTATGCCTTCTTATGGGCTTTCTTGCGATGTGCCACATTCAACCTGCCAGCGAGCGCCGTTGGTAC
CAAGGTTGAATCGGACTGCTGCTGCCCATGCAATTTTACGTGCCACGGCGCATGGCGGGAATGGCATTTCGTTTGGCGTGCGGCACTTGGGGATAAACAT
GCTTGGCAAGGTGGCTCTGCCACCTCCTATGGTGGCTACGGGGCAATCGACGCAATGAAAACCAAATAGCCGAAACCAAAACAAACATCCCGTCCATGCG
GAGTTTCCTGTCGCGACT