Description :
From Genome Similarity Track
Location :
Scaffold_79:15562- 19616
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_79-snap-gene-0.24HCF101 (HIGH-CHLOROPHYLL-FLUORESCENCE 101); ATP binding
Pytap_DAOMBR444maker-pag1_scaffold_79-snap-gene-0.25DNA polymerase

Sequence
4054 bases(100 bases per row)
CTGTGAAGGGTGCAACTGGCCAGGGCGGATAACCCAGTGGCGCACcGTACCCGCTGTATATGGaTGAGgtGGgAAGCAtGTTtGTTGGAAGCATCGGaGA
AAATGGCGATGAATAaGGAGAGAAATGGGAAGAaTACGGAGATGGCGCTGGAATGATATAGCCTTGCTGGTGGTAATAAGGTGGGACAAAAGGTTGGGCA
GTTGGATACTGACTGGGAGGATAGAGAGACTGTGTGAATCCCATCTCAGAGGTAGTTGCCGGCTTCGGGGCAAAGCTATTAGGAGGAGGAAGCAACTGTG
TACGCCACTCAGCAGCGTCCTGTTGCATTTTTGATTCTGTATGACCacTCGTGAGTTATGGAGCTGCCAACTCGTAATCAGATCCGCACCTCTCATGGCT
CTTTCAAGCCGACTTTCAAtcccccGACCGGACTGCTCTTGAACCTGATAAAAGCTATCGACTCGTTTCGAATCTTCGTCACGAACGCGGCGAGATTCTT
CTAGCTGCTCTTGAAGAGATCGTATTCGTTTCTGTTGCTTGTCCACGTCAACAAGACGACGTAGGCTCTCTTTCACATCTGGATCCTGGCGCCATGTTGA
AGGGACTGCGTGGTCATCAGGTTGATCTGACACAAATACACTTCGGATGGTTGACTGTGATGTCTTAGAAGGGCGGTTTTGTGGGGTCATGTTTAGGGAT
GTGTGGGCCGAGGTACTGGTCGAAGGGGaCAATGTATCTGGCTTGCTGACAGCCGAGgTCGAGACAACATGGGCAGCAGCACTTTGGATAGCTGAGCGTT
CGGGTGCTGATCGTTTGCCCAGTCGAACGCTTAGCTCCTATCAAAACCGCGTCACTTGTGCTCTTGCTCACATTGCAATCGTGCCCACATTACCTTGTCT
CGTAGCTCCTCATTTTGCCGTCGTAGCTCTTCACTCTCCACCAACTCGTGGCGCTGCAGTtCCTGCCTCCGCTCTCTCACTCCGCGCAGGCCTTGCcGCA
CAGCTGCCTCGCGTGACCACAACTCGCCCTGCTTGAGCTGTTAGTCTTTATCGTCTCGTCGCATCTACAGTCTTCATCGAGCTCGCTCCTCACCGTtCGG
ATCGCGtCcAGCTCCTTGCGCACGCGCTCCTtCTCCACTCGCAGCCGCAATTCCCTGTCTTTCGCCTGCTTGAGTTCTCTCAGGATAGTGTCCACATCCA
CGTCCACAGCTCTGCCGGCGTCTGCGTCCTTGCGGCTCGCCTTCTCCTCcGCTGACATGCCGACATGCCTGCATCCCTCgTACTCCATCGTGCCGTTTCG
TGCCATCTTgATTTCAACCAATCAGAAGCCTCAAAATAGCCCAATCAAACCCCAGCATCCATCACCACTGCTCCACCGCACAAGAATGGTGACGAGTATG
ATGACGCCCATGCGCCTGCCACGGCGTTGGCACGCGCTGGCGAGCCGCCGCTTCCTCTCGGTTCGGCGTGCTGCTGAGATGGAGACGCAAGTACTGGAAC
GCATGCGCTCCATTCAGGATGGCCTCGGGCTCGGTGATATCGTGGCTCTGGGACGCGTCAAGGTCTGGAATTCTTGCAACTCAGTCGCGATCGACCACTT
ACACATGGGTTACAATGCTCCAGGACGTTCAAGTGACACCAGACAGCGGCGCAGTCAAGTGCAAGATCGAGGCACCGACGCCAGCGCTCATGGAGCTTAC
ACagCAGGCAAGAGCGGAGTACTTTGGAGTCTTTGGAACGCGTCTCACACTTTGCTGTAGTGGAAGAAGGAAGCGCACGACAAaCTGCAAGCTCTGGACT
GGGTTCGTGACATCGACATCGAGATCACAAaGCCCAGGCCGCGCAATTCGCGTGCCGGCCGTTTTTCTTCACTCGGTGGTGTAAGCGAGATCATCGCGGT
GTCGAGCTGCAAAGGAGGCGTGGgCAAGTCGACCGTCTCAGTCAACCTGGCATTCAGTCTCGCGAAGCGTGGCGCGCGTGTCGGTATATTGGACGCTGAT
ATCTATGGCCCCAGTCTGCCAaCGATGGTCTCCCCagaaGACAAGACCATTCGAGTGTCACGATCGACGAAGAACTTCGTCGTGCCTGTGGAATACGAAG
GCGTGAAGTGCATGTCTTTCGGGTTCGTTAACCAGAAAGCAGCACCTGGAGCTGGAGGTGTGGGCGCCGCGGTGATGCGCGGACCCATGGTGTCCAAGCT
CATCGACCAGCTCGTCCTCGGAACTGAATGGGGCGAGTTGGACTACCTCGTCGTGGAcATGCCACCAGGCACCGGAGACATCCAAATCtCTTTGTCACAG
CAGATGGCAATCTCCGCCGCGGTTGTTGTCACCACCCcTCAGCGATTGAGCTTCGTGGACGTGGagaaGGGTATTGCCATGTTTGATGACCTCAAGGTGA
AGACTGTTGCAGTGGTGGAGAACATGTCCTACTTTGACTGCGACCATgaCCATCGACACTaTCCATTTGGTGCTTATTCGCATTTGATGCAGACATCAGC
TTTATCCTCTTGCTCACGCTGTTGCTTCGTGTAGGACCTGGGCACACCGATGAGCTTGTGGAAAgaTaCGCGATGAAGAATGTCTTCAAGATGCCTATTT
CAGCCAAGTTCAGCGCTGCCGGCGATtCTGGCCGGTGTGTTCCTGGTGTCAATACtGCTGCCACTCTGTGAGCTAACACTTCCCATGCGTCAGACCATTT
GTGCTGTCCAACTTGTCTGCCGAaGAaGAGCAAACTTaCGACGCTCTCGCGAAGAaGGTAGCTGAAGAGCTCGTCGTACTGCGTCACTCGGCTCGACTCG
CACCAGAGTTGCTCTACGACAAGACCCGTGGGATGGTCCTGCGtCTTtACTCgTTCACGgAGGCCAAGGAAGTTGTGATTCACGCTGCAGATCTGCGtGC
CAAGTGCCGATGTGCCCAGTGCATCGACGAATTCACGGGgCAACAGGTACGGTCTCGCTGGCTCCTCACGCACGTGTCAGAGAGTAGCGTCTGACTTGTG
TCTGTGCAGATCCTGGACgcTGGGtCCGTGCCCGATGACATTCGCCCTACTGCCGTTGAGCGCAAGGTACGCACGCGTtCCTGGTTCTCTGAACTCGGAA
GTTGTCTCACTCGTGCTGCTACCTCAGGGCAACTACGCCTTCGCCGTCACGTGGAGCGACGGCCACACGTCGTCTCTCTACACGTACGACCATCTCAACC
AGGTCATCGCCGAGTATGCGAGTTGAGAGAGTGTACTTAGGTTTCCGTAAATAACACCTGTTTCGTTCCATATCCAACGCGTCCTGGCGCGCCCGATGCA
GtAACTTGCCTTAAAGCAGGGCGCGAAATGGTGCGGCTGAGtGTCGAGGCCGTGGTGGTGgaCCATTACATGGCGCCGCCGCTGCCCCCAGACGCCCTGC
ATGGGCTGCCTGCATCGCCCTGTTACCTGCGCGCGCACCAGGTGCCAGTGGTGCGCGTGTTCGGCGCGACACCCGCCGGACAAAAGaCGTGCATGCACAT
CCACGGGGTgCGATCGATCACGCACCTCATACACGCGAGATACAGGGACTGACACTCTGTCTGTCGGCACCACGCAGCTCTTCCCGTACTTCTACTTCCG
AGCGGAGAGCGACCCTGCGTTTGAGGACCCGGAGGAGCTGAGGCGGCTGTTGCCCCGTATCGCAGTGGAGATCGAGACAGCGAACCAGGTCAAACAGCGA
GAGAAGacGgACAGGACGCCGCAGGCTCAGCCGCGAGACCGACGACAGACACACAAGCTCATTGCCAAGGTGCGGGAGTTGCGAGCGCAATGAAGGTGGT
GTCGGAAGCGCTAATGCAGTTGCCAAACCGTAGTTGCTCGTGGTGCAGGGAACGCCGTTCTACGGATACCACCCCAGCACAAAGCTCTTCGTTCAGATCT
TCCTGTAtAACCCGCGCTCtGTTGCGTCCGTTGTGCAGCTGCTCGAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN