Description :
From Genome Similarity Track
Location :
contig_30:155610- 157151
Transcript NameFunction/comments
g5298.t1hypothetical protein

Sequence
1541 bases(100 bases per row)
ACATTCCGCGTCCACATCTTGGCACGAACTACAGAAGCCGTCGTTGCAAGCTGAACCACGAGTTCCTGAGGAAAGCTTCCTGTCGTCACCCACTTGGACG
ATTGCTCTCTGCAACAACCAAGGCAGCAAGGTTACAAAAGTTTACAAACGCAGAAGCAGGACACACCATACCCGTCCAAGATGTTGACCGGTGGGAAGTT
CGGATCATACGAAGTCACCGCCGTCACCTGGGCGCCCTCTTCATCCAAAGCGAGCTCCATCGCGACCGAGACGACTAACAGACTTTCGGGGAACTCGGCT
CTTGTGATTGTGGTCTGCCTTCTGTCCTAAAAACCGCACAGCTTAAACTTAGAACGACGCCACAAGAACAAACATAAGAATAGCTTGGGACGCACTCATA
CTTATCATCTCCATTTGCACAACGCGGAATGCACAGGCGACTTTTACTTGAAACACCCTCCTAGATACCGACGTCGCAGGCCACAGCGGGTGGCTTTTTC
ACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTCTGCAGTCGCGGGCTCTAAATCATGTTGGAGGCTGCCCAAAACCCAATTCACTGGACAACCGCCGACC
TACTTACGTTGTCAGCGGTGGCTCAATTGACTCCTTGTACAGCCTCTCGAAACCCGCCGACAAAATGTCGGCTGCACGTGTGATACCCGATCCATCGTCA
TTAAAGAGCTTGCAGTTCGACCACATAAGGCGAATGTCGTTGGCAAAGTGCGTAGAATCAAGCTCCTTGACACCAGCCGCCACTGTGTTGCTGTCCACAA
TGTACGCTCCCTTCTTCAGCTTATCCTCGATTGTCGACAAGTCCATTGGCTGCTTCACCACCCGAGTGTACATCGGAATGTTCTCCACGGGCGTGAGGAA
TGGCTTTGAAAATGGATGCGACTTCAGACACGTGACAATTTTCAGGCACTTGTCCAGCAAGCCTTGCTCTGAAGCCACAGCTGTGGAATACAAATCGAAA
CGAGACGGCTTCCGACACTCGGCGCATTGCCAATCCCCCTCCGGTAAGTCACTCTCCTTCATGTGCAGACACTTTAAGTGGAAGGAGCGCGGGCACTTGT
CGCAGCACACCAGATCACCAGCACCCTGACAGACCTCACAGAAATCCAAGTTCGTGTCCAGCTCGCTATCTGAATCATCGCCCTCGTCTTCATCATCTTC
GTCGTCTTCTTCGTCCGCTTGGTTGTACGTTTCATCCTCTGTTTCTTCTTCGTCTCGTTTCACTCGCTTGGCATTCTTAGGAGGTCTACCTCTTCCCCGC
TTTGGGGCGGAGTAGATTTACGCTCTTGTAGATTCTTCCTCTCTGCACGAGGACCAACTGAAACACTGCTCGGTGTATCGTTTTTTAGCTGGCGCGGGCG
ACCTGGTCCATACGCTGGTGATGACTCCGCTGAACGACTTTCCTTCGGATGACGTTGACGAGCAGGGCCGTACGCCGGTGACGATTCCGCTGAACGGCTT
CCCTTAGATCCCGCCTCGGCTGTGTTTGCCTTCACACTACC