Description :
From Genome Similarity Track
Location :
Scaffold_281:15556- 19577
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_281-fgenesh-gene-0.2Notchless family protein
Pytap_DAOMBR444snap_masked-pag1_scaffold_281-abinit-gene-0.27Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_281-snap-gene-0.16Serine protease family S10

Sequence
4021 bases(100 bases per row)
AAGAAGATGAAGCTGGAGGAGCAGCCAGGCAGCATCTATGGTGCGGAGAAGCGCGTGGAGGCGGTGGCCGGCGGGgCGgATGAAGACGAAGATGAAGAGG
aCGAGGaCGAGTCGCCAATGAGCATCATCGCCCAGTTCCAGAGCGAAGATGTGCGTGTGTCTCGATGCAAATGAAGTGGACTAGAGGACTGATGGGACTA
TGGATGACAGGGCACAAACaCGGGGgCCnCAGCTCGATCTGCCGCTGAGCTCGAATGTGAATCAGATGGAAgAGCTTGtGAACCAGCTCTTGCAGCAGAC
CGgCGgCAAGCGCGTGCCATACACGTTCTtCGTGGgCgAGACTGAGATCACcAAGTCGCTGCAGGCGACGGTTGAGGAGTTGGTACGTGACATTGTGATG
ATGGAGAGCGtGAGCAAGCGAGTGACACGCATGCTCCTGTGCGTGTAGAAACTCTCGACGGAAACGGCGCTGTCCATCACGTTCCAGCCACTGGCGGCGT
TCCGTGTGCGTCCTGTGACGCGTTGCAGCGACACGCTGCAGGGACACTCGgAAGCGATTCTGCATGTGAGCTTCAGTCCGGATGGCAAGCGCCTCGCGAG
TGGCGGTGGTGATGCGACTGTGCGCTTCTGGGACACCAACACGTGCATGCCGAAGCACACTGGTCGCGGCCACAAGCATCACGTGCTCTGTACGGCGTGG
TCTCCAGACGGTGAGCGCTTtGCGTCTGCCGACCGCAATGGCGAGATCCGCCTGTGGGACCCGTCTACGGGTAAGCAAACTGGTCAGCCGCTCGTTGGAC
ACAAGCAGTGGGTCAACTCCCTCTCGTGGGAGCCGATGCATCGCAATGCAACGTGTGAGCGCTTCGCGAGTGCCTCCAAGGATGGCACCATCAAGATCTG
GAATGCACGCACAGGACGTCAGCTCGCGTCACTCTCTGGTCACACCGACTCGGTTGAGTGTGTCAAGTGGGGCGGCGAAGGTCTGCTTTACAGTGCATCC
CGCGACCGTACCATCAAGGTCTGGGCGATGGAAGGTGAGCACGTCGGAAAGCTTGtGCGTACGCTCATTGGTCACGGTCACCGTATCAACACGCTGGCCC
TGAACGTCGACTACGTGTGCCGCTCGGGTCCATTCGACCACACGAACCGCCGCTTtACCTCGCGGGAGGAGATGCAACAGGCCGCCAAGGAGCGATACGA
CGCTGTGCGTAAGAACCAGCCCGAGCGCCTTGTGTCAGGCTCGGATGACTTCACGCTGTTCTTCTGGGAGCCGGCTGAGAACAaGAAGCCAATCGAGCGT
CTTGTTGGCCACCAGCAGCCTGTCAACCACTTGTGCTTCTCGCCTGATGGTCGCTACTTCGCGAGCGCGTCGTTCGATAAGAAGGTCAAGATCTGGAATG
GACAGACAGGCAAGTTCATCGCGACCCTCAACGGCCACGTGGGCGCCGTGTACCAGGTGTGCTGGTCTTCCGACAGCCGACTGATCGTGAGCGCGAGCAA
GGACTCGACTGTCAAGGTGTGGGAGCTGGCGGACCCGAAGAACGCCAAGTCGACCCTCTCGGGCCACGCCGACGAAGTGTACGCGCTCGACTGGAGCCCG
AACGGCGACAAGGTGGCGTCCGGTAGCAAGGACCGCACGATCAAGATGTGAGTAGCTCTTGGTGCTTGGCTGGAGATGAGAGATGGGTTCACTAACCTCG
TTTTtGTGACTACAGCTGGCGTCACTAACTTGTTCCTCCACTGAATCTGTTTtAAtCATCTCCtAATAGAGTATCTGTATTCCCTCCGGAGCTGTTTtAA
ACACTTCCCGCCATCGGAATCCGAGGATGGCGGGGTCATCAGACGATCGACCGGGAACATGAAGCGCCAGCGTGAGGAAGATGACGGCGCCGCCGTGGCT
ATGCAGGCGACTGCAGGACCCTTCAGCTACCAGTCGCCACTGCGACAGGGAGCCCcTCGTGCGCCCTGGGGGATGGTGGCGCCCGTGGCCGACCACATGA
CGCCCGTCAAGCGCCAGCGTGACCGCAGTGTGCCGATGGGTGTGTGATCTCATGAGAGGGAGATGGATATCGAGATGATTCGCTGAATGGGAACATGGAT
GGAATGCAGACGCGATGAACCGGCTGATGAGCGCTGCGACGTCGGCaGCGCGCATGAAGAAGCGTGCGCAAATGACGCTCACGACGCTCTTCGGGgCCAG
GTCACTGGTCCAGGAAGCTGTGATGCCTACCTGCGACGTGTGCAGCGCCACGTCGACCAAGAAGATCGCGATGCCACCGACGCAAGGGCAGCGCTGCGCA
CACTGTGAGCGTGCCATGGGTCCATGCTGTGCGCGGGAATGTGACGAGTGCGCGAGTGCGTTCTGCTCCAACTGTTCCACCATCAAGTACGTGGATTGGA
TGACACAAGCTGGGTCTGAATATACTGATGATGTTGGTCGTGATGTGCAGCTGTGACGAGCAGTTCGACCGAGTTTtCtGTCTGTCGTGTAACTACGATG
TGTCGAGATGAGAGATCTCTCCCATTGAGGgCCgCTTGCGCCGATATCGATGCAGTGTTGTTTATCTTTATTCATATTAAATTGAACGGAACGTACCAAT
TTGAGATGGCGTTAGCGTTCACCAGGAGCAAGAAGCTTAAGTCAAGATGGAGTTATTACGGCCACGCGTGAAAAGGCGAAGCAGCTCAAGTGCGATCTCT
GGCTGGTCGTGAGGAACCATCTGCATCACAAGCGTCCGCGCCATGTCAGTGATTCACTTCCAGTTTAGCATACTTGGTCAGTACTTACATGACCAGACTC
GTACACCCTCACGAGACTCAGTCCCCGGGCCGAGCGAACTGTTCCAGCATCCTTtCCCTTCATGCGCAATGGTACAGTGCTTTTGGAGCGGTAAGCCAAA
GAGCCACCCCACACCATATCGCTTGTCCACCGTTCCTGCATGTTCCATGGTGCCATGGCGTCCGCGTCTCCAGCATACACAAGCACGCGCACCCCTTTCT
CGAGTAGATAGGCGACCTTGTTAGCGCTCTCACCCCAGAAGTCAATTTCACGGATTGTTGCCATGACATCCATGCTGCATAATGACCATGTATCGTTAGG
GACGCCAAAGTATTCGAGCACCTGCGGTTGGTTCACGTAGCCTTGGAGACGCGAAAAATGGTAGCATAGTCCAAGAGGATCGGCCACATGGCATGGACGT
CTCAGATCATACATGTTGTGGCCAGAGCCGACGACCCCCCTGAGGGCAGTTTGCTCAAGATTCGTAGCTGCGACAACCGCATCATGACACACTTGGGGTA
CGTCGTCCTCACAatCGTCGTCTAGAGCTCGTGCTCTCATCCGTCCATGTGCGGCTGCAGAGGTTGTTCTGGATGCACGGCATTGAAGCATCAGCTCTAG
AGCGGTGCTTTGGAGACCCTTGAACGTTTCTCTCGACACATCAAGCAAATTGGTTGCGTATTTGTTGTCCTCAATGAAGTCGAGGTAAGTCTGCAGCCCA
GAAATCGACGACACAACCCCGTTTCCAATACCGATGCCTTTCAGCGTGCGGCTCCATCGTTGAGGGTCATTTTTTATCAGTAAGGCACCGAGATCCGGGG
CGTAATGACCGCCGAAACTCTCTCCGAAGATGTAGAAGTCATTCATTTGGAGGCTTGGGTTCTTCTTGAAGAACGCCTTGACAAAAGCTGCCAGATCGCG
CATTGCCCCTcGTTCTGTCCAACCTGCCACACCTGTACGCATGTCACTGAATCCAGTTCCTCGAGGCTGATCAACGAAGATCACATGTGCGATGTTGATC
CACGAGTGCTTGTTCAACTGCATCTGGTTCGCCTCGTCGTCGAATGAGCACGGTCCAAGTTCGAAGAGAGCACCAACTAGGCCTGAGCATCCCGGGCcAC
CAGAAAGCCACAAGACAACGGgAATGGATCGTGGAGGGTCAGGTGACGATGACATGAAGAAGGCATAGTAGATACCATCCAGAAAGTCTGTCTGCCTGTC
CAGCTGCTCGCCACATAATGA