Description :
From Genome Similarity Track
Location :
Scaffold_208:15556- 17487
Transcript NameFunction/comments
Phyke_g8007heat shock 70 kDa protein, mitochondrial precursor

Sequence
1931 bases(100 bases per row)
CGTCGTGCACGTTGTCGTCCTTGGGCTCCTCGCTAGAAGCGCCCTCGCCCTGCTGAGACTTGTACACGGCCTCGCCGATCTTCATCGACAGCTTTTGCAC
CTCCTCTAGGGcagccttgatctcctccgTGTTTTCGCCCTcggccttcttctgcaggtCAGCCAGAGccgccttcaccttctcgaCCGTCTCGGCGTCG
ATCTTGTCCTCGTGTTCCTTCAGAGTCTTCTCTGTCTGGTACGCCGTCGAGTCGGCATCGTTCTTGGCCTCGATCAgctccttgcgctcctggtcagcag
cggcgttggcCTCAGCGTCGGCAACCATCTTCTCGATCTCAGCGTCCGACAGGCCGCCGCTCGACTGAATCACAATGTTCTGCTCCTTGCCAGTGGCCTT
GTCGCGAGCGCCCACGTTCACAATTCCGTTGGCGTCAATGTCGAAGCTCACCTCAATCTGGGGCACGCCACGCGGGGCGGGCGGGATGCCCACCAGGTCG
AAGTTGCCCAGCAACTTATTGTCAGTAGCCATCTCACGCTCTCCCTGAAGTACCTTAATGCCCACCTGTGTCTGCgagtcagcagcagtcgagaaTACCt
gcgacttcttcgtcgggATTGTTGTGTTACGCGGGATCAGCTTCGTGAACACACCGCCAAGGGTCTCAATGCCGAGCGACAGCGGTGTtacatccagcag
caggatgtCCTTCACGTCACCACGCAGCACACCGCCCTGGATGGCAGCGCCCATGGCAACGACTTCATCGGGGTTCACACCCTTGGAGGGCTTCTTGCCG
AAGAAATCCTCCACGGTCGTCTGAACCTTGGGCATACGCGACATACCACCGACCAGAATGACCTCGTTGATCTCGCTCTTGTCCAGACCAGCGTCCTTGA
CACACTTCTTGCATGGGCCCATGGTGCGCTCAATGAGCTTGCCAACGAGCTTCTCAAAAGTGGCACGCGTGATCTTCATGTTCAAGTGCTTGGGGCCAGT
GGCGTCGGCCGTGATGAACGGCAGACTGATGTCCGTCTGAGCCAGGCCATCAAGCTCACGCTTGGCCTTCTCGGCGGCCTCACGCAGACGCTGCATAGCG
AGGTTGTCGCCTGACAGGTCAATGCTCGACTCCTTCTTGAACTCATCCACGAGgtaacgcagcagctcctcgtcgaagTCCTCACCACCGAGCAGCGTGT
CACCGTTGGTGGACTTGACCTCGAACACACCACCGGAGATCTCTAGAATCGACACATCGAAGGTACCTCCACCCAGGTCAAACACAGCAATGACCTTGCC
GTCCGCCTTGTCCATGCCGTAGGccagagcagcagccgtCGGCTCGTTGATAATACGGAGCACGTCCAGACCGGCAATCTTGCCGGCGTCCTTGGTAGCC
TGACGCTGCGAGTCGTTGAAGTAAGCAGGCACAGTCACAACGGCCTGCGTGATGGGCTTGCCCAGGAATCCGTCCGCAgtctccttcatcttggtgagCA
CCATGGAGCCGATCTGCGAGGGCGAGTACTTCTGTCCCTTGGCCTCCACCCAGGCGTCCTTGCCGTTATTTCCCTTGACAATCTTGTACGACACCACCTT
GGACACCTCCTGGGTCTCCTTGTCCGAGAACTTACGGCCAATCAGACGCTTAACGGCGTAGAAAGTGTTCTCCGGGTTGGTCACAGCCTGACGCTTGGCG
GGCATTCCCACCAGACGCTCGTCGTTGTCAATGATAGCCACGACGGAAGGTGTCGTGCGTGCACCTTCCGAGTTCTCAATCACACGCGCGGTCTTGCCCT
CCATGACGGCCACACACGAGTTGGTCGTTCCCAGATCAATTCCGATGACCTCGGATCCAGCGGCGGCCGAGAACATGCGCTTGGCAGCGACGGGGGCGTT
GGAGCGGGTGGCGGCTAGACGCAGCATCCTG