Description :
From Genome Similarity Track
Location :
Scaffold_79:155501- 160297
Transcript NameFunction/comments
Phyca_LT1534555898Hypothetical protein
Phyca_LT1534537237conserved unknown protein

Sequence
4796 bases(100 bases per row)
tcaaagtcgcagtactggagcagaagcacgctatggccacgactcgactcgcacagcaagctgccagtagtgacgcacaagtggagaagctggaggctga
aaagctcgagctcctcgcggctgtgcaggagcaacaggagcaattgaagcagctgaaactagctctcggcggtaaacagatcgtggatgcctctcgatga
acgcgagtcgataggtgaagcccccatgattgatttttcttataagtggtgaatgtgcagcctcagcatactgcgctgaagcaggaaatgcacaagactg
ggaggccggaagggggaattatctatgaacagcagcaaattgacaatagagagaggagaagcatcagtgcactacctgtagatgatagacagtctacctg
tggtctgctgttcagctctccgctctctcctggcaatccctagcacgcttcacagcacacaccatagctgaaagtggtaaggacgccacaaactatagat
taacaatatcaacagcacagccttgccacctggatgcacgcccagagctgctgaagttcgtggtatattacgaagtcgcgttaaacttcacccggatctc
ctcctcgcttaacagaccggcagtaatcgagttgatgttccccgtgaacacgcgtcgttcccatgttgccgtgtcgaaatacaggaactgcggcgccatt
gagttgtttgctaatgaagatcctgtgctggcgctaccaatggagccaatgctgccattgccatttgcaccggtgggtgacccactgcttgaccccccta
cagaagagtttccattaccagccaatagagcagcatcagctggagacgcccgcttcaaccaggtcttcagttccgcgtgatatctccactcgcggctgta
cagctcctgagcggcatatgcctgcaagacatccttgggcatcgagtagaagatgaagaacagcgtctcaaggtgaaatttggacaggtgagttgtcttg
agcactggaggctggttgtaatagcacattggcaacgagaattgcggctcttttgtcagctgctcctcggaccagggggatgcaaacgttgggtacaatg
gactagacaacagcaaagacgttcaacattaatttgcaagtacacgcaccaaaacaagcttttaggaacgtactctgtcgagttgagatttaatcccaat
gatgtcaaatcgcagcccatcgccaggttcttcttcgagtcattgcttggccgaatgatagtgtgcagcattcccagaagtccgtactgattgctcggat
ccagctccccgttgctagtttccttcttcacagtctgttcgtcctgtcgaggcgcccggaaatgatcaaacgcctcagtgcctagatttacactgccacc
ggatgctgcctgtactgcgttgccagctcgactgcctatagaagtgcctcccttctgctgctctaaccgtgaggacaccataccgtccgctgtagacgac
gtgaagctcgagtgtctcttgagttccggaggtggttgcaaggggttcttttcattcgcagcaggtccgaacgttgacagggcagggaaatcctcctttt
ggatgacaaattcggacggttgtgcgcgcatgcggtccgctgcagtgccttcgaagctcgagtccagcgacagagaccccatcctgaacccactagttag
ctttatccatagcaaaaccgataacgaagcctacctagacccaagagcagggaactccgacatgtctggcgccttgttctctgccggcatctggaaattc
cgtcctacgcaacaaataacagcaataaatgagttttcatgatataccaccgggccttaaaccgttttcctcttatcaacgcaccggaattaattcggtg
cagctcgtgagtaggtggtagcgctcctgttcccacttgcatgcgtccgattccagatccacctaaaaactgcaataaaatgttaacaaaacagctaaaa
acagctaaaacttcagcaaccaaccgaactggagctgccctgcataagtccgctactgtaccccgcgtaggtgccctgtaactgcggtatattggaatct
gcagcctctgcatccatcgctccagctcctaagccactagccatggcgtggaaggacgagagactgaggtgggggcctccactgctgctaagtccgttac
tggcacttcctccagggcctttggcgctcgagaactcgtcccggtggtagtaatactgactggcgtcgaattcctcctgagtaaaataaagttattattt
aaagtattagttaagtaacgatggagggattaatggagagtatggggaccttatcctcggccgtctggatgttgtccttgaagtaggcgaatttgtcctt
ggacggatcgatcattgccagcggacggagggggcgaaaggcgtcaactccgcttatgtgtggcgttttccccttgtgaaaaatggtgtagaatacccca
agtagtttccggcttaagtgcggattaaagtgtgaatagaatcgtattttaatgagtcttaacagtaatttatctcaataaaatacgaccttcccaccgc
gtagacctatccctttcgggcgtcgtagtctactaacctttcgggcgtcgtagtacgacgcccgaaaggggtaggtgatgtcacagatgagcaaagcagg
gccagatttagggtctgggacgtttgaaaaagctacgggaagaactccactacacaagacaagtccgaggagcactctaaagcaaattggctataaagtc
attggctaatagacaataccattccatacccaaaagaaattccatccaatcgcatacagtgcagggggtggccagcagtgcttacccggcactgttaaat
ttacgctaattccagcatccgtccctctctctctccactacgatggtctttctgcatccctggctagtgctcgcttcggcgttgtcacaagggcaaggca
acatttagatgatagaaatgaagacatacagagtcgaaaataaaagtgatctgccaccttgctttgttttgataccacccccccccttattcaatgcgtg
tgcagcgtcttcgctgtgcctgtacgacctgctctcacgtaacagtgacttgcccctgacgtgcgcgagtaatgacctgtcaaatcccgttcgtaatgac
tgtggaaggtatacagccgcaacttagcgcgtgggtctcggaagcctatcttaacagcgccgatgaaggatgtcgtaaaagcctgggctactcaagacct
aaagcccaagcgcacgcacagtcttttacctgagcgctttaacttaaccgagacaacggcgctggggctaactaccattcagcgcttgtgacggctcggc
tcggagtgacttgtagtgacctacttggtgctgtaaggcagcagataaaggaaataggttttactggggacgaagagaagccaacggcttttactttcac
gagccgtagcgatggagatagaaaaccggagactgggaatggaggtgactccgccccattcgtgatagggatacgctcaaaataacttcttccgcgagcg
aatcgtggcccgaattcgtttattctacatctcgatgcagccttcaagctcacacagctcgattaccttgccatttttgtcgtgggggtatcagataggg
acagacgtgtccattttattgccacctttgttgtctcccagctctaacagcatcattacgcggatgtcctgcagattcttgctcgggtgtacttttccgt
tgctggaaacatgattcaagcccgccacgtgatgggtgatgctaaatccagcccagctgaacgctgtctacaatatatttgggcagaggtttcaatatgt
tcccctgttgtgctactttcacgtgaccaaaaaggtacccgttcacttctcccagagacggctgctgttgtaacgaaacgcattcatcagatgcactttt
ctaaggacgaaacggaatatatgaaggtactcgcaacgcaacaagacgaaataattgactatttgtttttgaaaaatgtaactttttgattcatttattc
tacgcgatcttcgatcttgcgtttatcaattactagtcttattttaactaaaacgtatcttagctttacttgaatcgatctaaaaatgctaaatacgtac
ttaatccgccataacgactcttacgtttatgacgatacctataaaattcaactgttatcgtacatgttgtaaattttctcagttttaatgtatatttacc
tataaagttacgctattacgatgcaaatttcatcaatcacaacaaaatgaaactcattttacgggatgcaaggtctgttgtaggagctttagacgaaaat
ttcattatcccatggcgcattatcccattacgtccgttttaatttttgtatgggataaaggtaaaactaactcccgcgtgatttctgtttccgggagtag
ttttgaagtagttttggagaaaccaacagactatctcatatataatttgtagatttcattgtttatatattcataaaacataaagcttaaaaaagatagc
atttcatgtaaagatcaaatttattatgtcatacttcaaaaagatatattagtaattgcaaaaatcaagtttacatcatgacaatttttaatataatttg
tgaataccgaaatagttaaatgatccaccttttttaaatagaccaccaatttgtataatttggtcgtgctatcacacctcgagctccgtagcctcg