Description :
From Genome Similarity Track
Location :
Scaffold_396:15550- 18125
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_396-abinit-gene-0.21Formin-homology 2 domain-containing protein

Sequence
2575 bases(100 bases per row)
AAAGATCATCCCGACTATGTGAAGTTTTTTAAGCTTATGTCGATGGGTTTGCCAGCTGAACAGGTCAAGATGAAAATGCAGCAAGCAGGCGTGGATCCAT
CCGTATTAGACGACCCCGAAGCGATCATTGGTGGCAGCGGCGGTGGTGCATCCGAGCAACCTGCAGCAGACGTCATGCTTGTGAAGGATGATGAGAAGTA
CGCCAAGTTTTTCAAGCTGGCGAAGATGGGCATGCCTGCTGAGCAAATCAAATTGAAGATGAGCGCAGAGGGTCTCGATCCATCTTTACTCGACATGCCT
GATGCTCCGATGCCAGGATCGCAGCCTGCTGTAGCGGCGTCCCAGGTTATGGCTGTGAAGGACGATCCTGAGTACGAAAAGTTCTTCAAGCTGATCAAAA
TGGGCATGCCTGCGGAACAGGTCAAGATGAAAATGAGCGCGTCGGGACTGAATGCAGATTTGCTGGATACGCCAGATGCACCGTCGCCGAACCAGAAAAC
TGGTGCTGGAGGTTCCAGCGGTGGCGTCCTTGCAGGCCTCCCACCGCCGACAGAAGCAGTGAAGGTCGATCCGTCAGCATTGAAAGCGAGTTTGGCCAAC
AAGCTGCAGCGCACATCTTCGAAAAAGCCTGAGGAACCGCAATTGCCGAAAAAGGAGACGGTGAAACCGAACGTCGAGCTTCGTCCGCTTTTCTGGACGC
GTGTTCCGGTGAATGTGGTGAGCAGCACGCTTTGGGTGAAGCTGAACGATGCGAATGGCGCGTTCGATGTTGATGAGATGGAGTGGATGTTTCGCAAGAA
CCCAGTTGACAACCAGAAAAAAGACGATAAGAAGAAGGATGCAGCCAAGGAAGCAGCCCAACCGCAGACTGTGCTGCTCCTTGATCCAAAACGACAACAG
AATGTTTCCATTGCGATTGCGCGTTTCCGTATGTCAGCAACAGACATCAAGAATGCGATTTACGCGCTCGACGGTTCGAAGCTCACTTCTGAAATTCTGA
ATGTCCTAATTTCGATCTCCCCAACGCTGGAAGAGCAAGATCTGATGAAGAATTATGATGGGGACGAAAAACTGCTTGGTAATGTGGAGAAATTCTTCCT
TGAGCTGTTGACGATTCCACGCTACACGCAGCGAATCAAGTGTTTTCGCTATAAGCTTCAGTTTGAAAACCGTATTCTTGAAACTCAAGCGCAGTTGGAT
ACGCTCGTTGCAGCGACGGATCAAGTGGCTGAGAGCGATAAATTCCGTCGTGTCCTGGAAAACGTGCTAAAGATCGGTAACTACCTGAACGGCGGTACAC
CTCGTGGTGGTGCGTACGGTTTCAAGCTGGACACGTTGACGAAGCTTCACACTCTGAAATCCGTGGACCCGCGCATCACGTTGATGCATTTCCTTCTTCG
CCAATTAGAAGAAAACTCGCCAGATATCATTGCCGTCGCTGGTGAAGTGCCGCACATTGGTGAAGCGAAGAGATTGTCACTGGATCAACTCCGCGCAGAT
TTGTCGTCTTACAACACGGAACTAGCGATGCTGCAAGGCCAAGTGCAAGCTTCAAAGAACGATAAAATCGAAGGCGACAAATTTTACGAGCAAATGGCGC
CGTTTGCACAAGATGCGGCGGAAGTGCTGGAAGAGCTAGGACGTGATTTCAACGCCTTGGAGAGATCGTATCACGAACTCGTGAGCTCTTTTGGTGAAGA
TCCGAGGAAAATGGGACCAATGGAGTTTTTCTCCATTCTCGAAGAATTCGTGAACGAATTCAAGAAAGCATATCGCCAGAATCAGACCAAGGAGTTTCAA
GCAATTTACGAAAGTGCGCGAGAAGCAAGAGCAGAAGCTATACGACTAGCGGAAGAGGAGAAGGCTGCGCGGCTGAAGAAGGAAGCAGAAGAGCGCCATG
CTGAGGAAACGAAGGAGGTGTATGCGCATGTGATCAACGTCATCACTGCGTGGGCTCAATCCCACAAAAGTGGCCACGAAGCAGAAATTGTGGAGCACTA
CAAAGAACTTTCTCGTAGCTTTGCTGATAGTGAGATTACTTCAGACGAGTATTGCGAACAGATGCGGAAGCTGGTCAGCTCCAAGATTGCTGGGAAAATT
ATCCCCGACAGCGCGAAATTGTTGTTCGATTCGGCAAAGAGAGAAGATCTAATGGCAGCGTTTGGTCGTTTCGTTGAGCAAGTGAAGAAAGAAAAAGAGT
CGAAGAGGAGATCGTCGTTGGTGTCTCCGCCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCGAGCGGTTTCTTCCGGAAGCAGG
AGACGGAACAAGGTGTCGGTCATCAAAGTGGAAGACATCGAACCTGTCGTTGGTGAAGCTGCTGCACAGCTGCACAAGTCCATTTTAGAATCAGTCCAGC
AGGCGTTTGGAGGCGACACGAAGAAGATGAAAGTGTTCACGTCGAATGCGCGCAAGTACGGCAGTGAACAAATCAGCGCCCGTGAATTCTACCAGTATTT
AACGGCTTCTTTCGAACCCGACTTTGTCGGCCGACTGGTGCCGGACTTGGCGCGATTGCTGCAGGACTCGGAGAA