Description :
From Genome Similarity Track
Location :
Scaffold_24:155403- 161064
Transcript NameFunction/comments
Physo_133080reverse transcriptase

Sequence
5661 bases(100 bases per row)
AGGAAGAGCTCAGACAAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTA
CGCTCAGGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTG
TGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCAGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGC
ACATGTTCCGAGGCCACAGCCACGCCCGGTAGTGCGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCCGGACCCCAGCAGTTGCAG
GGAAACAATGTGCGATGCTACCGATGCGGTAGAATCGGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGACGGTGCCG
GGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGAGCGGGACGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTG
AGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCT
CTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGAGGTAAAGATACCTCGAAGTAT
GTTGGAAGTACGACTGGCAACGGGCGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGTACTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTT
ATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGC
GCTTCGGTCGCGACAGCAGAACAGTGAGCGATGGCCCTGTTGCCGCTACACACGCACCAACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGC
CGCTGTCCCGGAGCGCCCTGGGCGCGCGAGAGCACACGCGCAAGAGCAGTAAGCGTCGGCGTCGCCGCCGACGGCTAAAGGAGAAAATGTGTTGATCTCG
GAGATCGACGCCCGCGTTTCAGCGAATCAGGTAGAGTCTCCGACCTCAAGAGGTACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACG
CGATTCTGATTGGATCAGTTTTGGCCAATAATAAGAGCCAAGGTAACGAAACACCGTCGACTCCGGGAGTCGATGGCTGGGGTGAATTTGATTCGTCGGC
TCGGGGAGCCGACGCATCCTCCGTAATGGGGGTCTCCGCCAATGGTTGGCGTCGAGGTGAAGACGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGACGGT
GCGGACGGTTGCAAACGTTCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGGGCTGCTCGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGT
CGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAGTCATGCGGAGCCGGGCTCCGC
AGGACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAGGTCTCGGCCTGGGGTCGAGACGCTACAAGAAATGTCTGCCGGGCAGACGGAGGCTGAGAAGC
CGGACGTCGAGACGTTGAACGTCTTCACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCGAACCCTCTGACGCAAGCGTCGGAGTTGAC
TTCGCTTCCAGTCATGAGCTGGAAACGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGGAAATATGCATTCTCTCGGACACCGAGAGAACGAAGAGC
GAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTG
GGACTCGTTGAAAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGAATC
CAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGACAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGA
GTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGTGGTTGGCGCATCGTTCATGC
GTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCATGAGCACTATCTACAGTGCT
CTTGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGTTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAG
TGATGCCGTATGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGA
TGTGTTCGTCCACAGCCGAGCTGCGGACGGGATGAGCGACGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTC
TATGCCAACCTGAAGAAATGCATCTTAGGGGCGAGCGAGATCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCA
ATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACG
CCCGCTATCACAGCTCCTGAAGAAGGACGTCGAGTGGATTTGGACTGCTGAGAGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCTG
ATCTTGGCGGATGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCC
TTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGC
GAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTACACAGACCACGCGTCGCTGTGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGG
ATGGCGAGATGGCTCTCATTCTACGCAGAGTATAACTTCCGGGTTAAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTG
ACTACGCCACGACTGATGCCGACATCAATGCCATTGACGCCATGTGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTTCGCACA
CGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATTTTCGTGCTCGTACACACCGTTAC
CGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGTCCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTACG
AGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTTTTCTCACGCGAGGCTTCTACTGGGCCCACCAGTACAAATGGGTGCG
CAAGTACGTCCGTGTTCGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGAGAGTGTTGGCAG
TCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGTCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACTGCTTCAGCAAGATGGAATATCTTG
CTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACTGCACGTCTGTTCGTCGACATGGTGTTTAAACACCATGGCATGCCAATCGACATTGTGTCGGATCG
AGACCCGCGCTTCACTGCGCACCTTTGGCAAGAAGTGTTTATACTTCTTGGGAGTCAACTTTCAATGTCGACTGCGGACCATCCGCAGACGGACGGGCAG
ACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTGACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCGCTATGA
ACAACTCGGTGCATGCCTCGACCGGGTATACACCCTTCTACATGAATGCCATGAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCAT
AAGTGGGGGAGGATCTCCGACAGCACCGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCAACGATACGAAGCAAAGCCGAGAACCGC
GCGTCTGTGCAGGGCACAGACGCCGACAAGCGCACGAAGAACGTGTCTGTGCGAGGCACAGACACCAACAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTGGAAACGAGCTGAACGAGTTCAGCTCGGA
CGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTT
GGCAGGGGCAACACTAATGAATTCGAGAAGGGTTCATTAGTCTTGTTAGCTACTCAAATCCTGCCTAAACACGCCGTTTCCGACTTCGGGGCGAGCAAGC
TCGCTCCGCGCTTCATCGGACCGTTCACTGTGCTGGCACGGCACGGCAACGCCTACACACTGGACATACCGTCTAGTATGCGCCTCCATCCGACGTTCTA
CGTCGGACGGCTGAAGCCATACCTGCAGCACGAGCTACCTAGCTCGGCTGAACCGAAGCAGAAGACTCGGCGGAAGCCATCATCCTCTCCAGCGCGACTT
CGCGCTGGAGCAGCGGGTCGAGCTAATGGTCCAGCTCGGCCGGAACGATCGAGGCGGCCTGGGAGGCCGCCGCAAACTGCGAATACTTCAGAGCGCCGAA
CGCAGCGCTCTGGAACTACTCCACGACCGGGACTTGGTCGTGGGGAGACTCGAGATCAGGGTCAACACCAAGTTGACCACACACGGGGTGTGTTTCCGCC
ACCGCCGCCGCCGATTCGTGATGCACACGGCTCAACTCGATGGATTGTTGAGCGGATTGTTGATCACAGTATCCCGAGAACGAACAGGCAACCGGTTCGT
TTTCGTATCCGTTGGAGAGGATTCCCTCCCAACCAAGATACATGGTAGCCGCGGAACGTCTTGCTCGAAGACGTCCCGGACATGGTGAGGGCGTACGAAG
CCCACCATGCGCTGCACACTGGGACGTAATGCGAGCGCTGCTGTTAACAGCAGCGCCCGAA