Description :
From Genome Similarity Track
Location :
Scaffold_1385:1554- 2743
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1385-snap-gene-0.1Arabinan endo-1,5-alpha-L-arabinosidase A

Sequence
1189 bases(100 bases per row)
TTTACACCACGGGCCAACCGGTCGAGAAGTTGATCTTGTTCCACCCGAGCTTCTTCTGGCCATCAGCGTAGCCAATGCGCGTGTCGACTAAAAGGTACAA
ACCGCGACATCATACACGACAGTGAGAATGAGCCTCCACACATAAGCAAGCACACCGGACAGCAACACACTCGAACCCTTACCATAGTGGTAGTACAACA
CCGGCCCGTACTTGCGGTCTTGGATGACACCCTGCCCACCTGGGCCGTACACGTAGTCGTGGGACTCGAGCACGACGGTGCCGCCGCCGTTGGTGCACGA
CTGGCCACTCTGGTCGACGAACCCACCAATCGCCGACGTCGAGCGGCAAACCATTATCTTGTACTCGGCACCGCGCGCCGGTCGCTTCTTGTCAAAGCCA
CAGCAGCTGCCCTTGGAGTAAAAGAGGTAGTAGTGGCCGCCGTGCTTGAACATGAATGCACCCTCCATAGCCGTCTCCCGTGCGTTATACGAGATTTGAT
ATGGACCACCCGAGGGTTGACTCGGAGAGCTCATCTTGGCCTGGTAGATGTCTCTCCAGAAACTACCAAAGTTGAGGTAGTGCGTACCGTTGACGTTGAT
GTAATTGGCGTCGATCGCGTTATATGGACTGCCGACCGCGCTCGTGATCACAGGCGCCGGGTGGTCCGTCCAGGAGCCCACGTCCATGGTTTTGGACGTC
GCATAGCCGATTGCGGATTCCTGGGTGCCAAACTTGCTCATGCTGTAGTACATGTAGTACGTGCCGTCGATGTATGAGACGTCCGGAGCCTGCCAACAGT
AGACATTGTAAAGGCGATTACACAGAATGCAACCATCTTTAGTCAAACGAGGTCTATGCGCTTGAAAGGGGTAGTGCGTTGGATCAGTAACTTTGCTATA
CGTACCCATAGGTCGTTGCTGCCAGCGTGGTTGACCTTGGAGCCGCCTGAGATCGCGTTTCCCTTGTATGCCCACGGGCCACTCAGGTCTGGGGCCGAGT
GGACAGCGATGCCTCCACCCGTGGAGAATCGAAAGTACGTGCCGTCCGACCGGCGCACGATTGACGGATCGTGCGAGTTGACGCACACGCCCGTGCAGGT
CTTCGGGTCCGCGTACGCGTTGACGAGGCTCACGAGCAGCGGTAGTCCGAGCAGGAATGACACGAGCTTGACCATGACTGTAGACGTGG