Description :
From Genome Similarity Track
Location :
Scaffold_588:1554- 2674
Transcript NameFunction/comments
g10302.t1hypothetical protein

Sequence
1120 bases(100 bases per row)
CTTCAGGCGTGTCTCCTTCAACTTAGTGATGAACCGGCGGATGTGCTTCTCCAGACGCTTGGTTGACTTCCTGAAATCAATGTCAGCCTTGCCTGCAGCC
GAATTCAGGCGATAGAAGAAATCTAGGGCACTTTCAGAAGATCGCATCTCCATCGTGTAATACCGTTCAGAGTAAGACGCGCGGGCCTTGCAATACTTCT
TCCGGAATGCCGTCGCCAGTTCTTTCAAATGTCGCTGCGTGTGTTTCGGCAGTTGGTTGAACCAATCACGCGCTGCTCCGGACAGCTTCAGCTTGAGTTC
CTGGATTCGCATCTTGTTCGACCAGGCACCTTGGGCAGCCAGGTTAGCAAACTGCTCCCACCAGTGGACACGCTCCCTGATCGCGGCCTTAGTGTCGAAC
TCGCTCAACGTGTGCGAGTTGATATACGGCCGGAATGTCAGCAACGTAGTCCCTTCTGGTGTCTTCGCCGCGGTCAGGTTACTATCCGCATCTTGCCCGA
AGTCGTAGTCGGACTCACTTGAACTAGAATCCTCGCTGCTCGAGTCGCCACTTGGGTCCGGATCCGCTGGTGGGCTAGCGTCCTGACGCTTCTCCTTCTT
GGGCGGCTTCCTCTTGTCGTCGGAGCGCCTGGAGCCAGAATGCGGAGTTTGCTCTGCACTGGATGCACCTTGTGTCCTGGATGCGGACTGCGCCCTGGAT
ACGAACGTCCTTGTTGTCGCCCCTTGCGTCGCCTGGACACTTTGCGCCGCCGCGGCGTCTTCAGCACCATTATCCCTCTTCACATGCTTCTCTTGGTTCT
GCGGGAATGGCTGCTGGACAGTCGCGAGCAATTGTGCGGCTGCGACTTCGGTCATGTTCTTTGAACCCAGATTTCCATCTCCCTGATTTGCGACATTTGC
GACATGTCTGATGACGCCACTGATTTCTGGATACACAGTTGCTGAATCAGGGGGAGGAGACCCTTCAATCTTGACTTGAGTTGCTGAATGAGGGGGATGA
GTTGCACGAAACGCTTGAACTTGGGCCAATGTTGCACGAAGGTCGCGCAACTGCCCAGCTTGAAACTTCTGCATATTTTTGGAAGTCTCACGTTCTTGTC
CCAGTGCAGCCTCTGCATCT