Description :
From Genome Similarity Track
Location :
Scaffold_113:155394- 160038
Transcript NameFunction/comments
g2396.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g2397.t1hypothetical protein

Sequence
4644 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAATGGATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCACATGACTGGTAGAAA
GTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAA
CCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACT
TAAGTTAAATACACCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTC
CGTCCAACGACCGACTAACACGTTCGTATGGAATACGCACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTG
CAACGCATGTTGCGCGTGCAGACTGCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACG
ATGTTGCGAACGCTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGAAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCAT
CGGCCACACCGCGCGTGGAGTCATTGAAACTGCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGC
CATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTC
ACAGATCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCC
TCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATTGACGAGGCGACAAA
GGTCGTCACGTTCATGAAAGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCCCGCAATG
CAAGAAGCGTTTAGCCTACGGCAGGCTAAACTGCATGTGAACGTCCCGCGGCTAATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGG
ACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTG
CACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGGCGCCCCGCGCCTG
CTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCAGTGAGAGTCAATCTCACGGCAAGAAGCAAGATGACAAGCCGAACCTT
GTCATCCTGAAGGTAAGCTCGATGAGAGAGATCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTT
GACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCT
CTTATCAAGAGAAGGAGTTCGTCGACGAACTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCC
GGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGT
GCATGCGGCCCTCCATCAGAGACAGCGCGGGATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAAA
CGAATCAGCAGGGCCTGATTCAATCGGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATGTCGACACACAATTTGTCGA
AAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGGCGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAA
ATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAAT
ACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCAAACTAAGCTGCGCAA
GTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTACTGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGT
ACTGGTCTCCAATACAAGAATATGAGGCTGGAGAATCCTCCGACGTTAACGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCG
AACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCAGAATCAGCTCGTCTCTGAGGGCGC
GGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAACAAGGCTGGGACTCGCTCAAGGCGAGACCCTTTTACAAGGTCTTGCGTGAGTACAAG
GATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTGCGTCACGCGGCA
GTGGCCACTGCCGCGTGACGCAAGTCAAGGCAATCGACGACTTCTTTAAAAGTCGTCGCAATGCAGGACAAGTGTGGGAATCGAAGTCCCCGCACAGCGC
GCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGGTATAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTC
GAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGAATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATAT
CCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTC
ACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGAAAATCGGATGTGGAGATGC
ACACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCAACCGAGATACCCGTACT
TGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGCGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCAG
TTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTACATGGGAAT
GGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGT
GCGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCA
GCTGAGCGTAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGG
TCTACACCGACCACGCATCGTTGCGCACGGCGACCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCA
GGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCACGAAGCCGACGCCAACGCAGTTGGCGTC
GTCAGGACGACCACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACAC
CTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGCGTACACCGTTATCGTGTACACAATAGTCTGCTGCTTTACAGCGCAGTCGACGA
CAACGCAGATCGCATTGTCGTGCCGAATGATCATGAGTTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGAGACATCCTGGCCGTGAG
AAGACATACTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCA