Description :
From Genome Similarity Track
Location :
contig_66:155390- 156888
Transcript NameFunction/comments
g9592.t1hypothetical protein

Sequence
1498 bases(100 bases per row)
TAATGTGTGGACAGCACCCCCAAAGCACGGGATTGTTTTTCAGTACTTACTTGGAGCCAATGTTGAAGTTGACGTTACCAGGGATTGATGCGAATGATGA
GAAGAAAACACAAGCGACAGTTCAGCTGTATTTTCACATACTTTCGTGGCTGCCCCTAGTGAATGATCCGGCTAAGGGTAATTTCCAGGCAACGAAGCAG
CGAGGGGAGCTGTCAAACCAATTGTTTGCAGACATGAAAAGCAGTTTGTTTGCTGAAATCTGTTCTCTGGGCAGTCAAATTGACGAAAAAATGTGGGAAA
CTGGACCGTTCTTAGAGGAATGGACGTTTGCAGTGTTGGATCGTTGCTTTCAATTCATTCAGTCGCGTTCGGGTGCTAGGTCTGCCTCGCCCAATGCTGA
CAGAAGCGGGAAATCTTCCAAAAGAGATGGAAGTGAAGACGCGATCGTATTGCAGGTTTTGAACCTATTGGCCATTTTGTATGTACAAATGTCCCCAGAA
ATCTACACGCAGTGCCTGCGCAAGACTGTGGCTTTTGTGTCAAGTGCGTTCTACACTACAGCATTTGGAGGAAAGGTAATATCGACGTTGATCTTCAATT
GCATGCAAGGAAATCCTTCCGAAGCCATCGCGCGGTTCATGCCGCTTGTTCTGGAGAATTTTCACGCTACGAAAACCAGCATTGATGTGGTCGGCTTGAT
GACGAACGAAAAAGTGTGGTACTTGCAGATTCTCAACGGCTTAGTGCGCTTTAGCCACCAAGATGATCGCATTCTACTGCGCTACCAGCCCGAACTGAAA
TTGATTCTGGCACAGTTTTTGAGCAGTGACGATGTCAAGGACGTCTACGAAGCTGCTGGTGCTGTATTACGGCATTTGCTCTCGGGTCTTGTAGGAGTTT
ACACGCACGACTTTCGCTCGTTACCTGCTGCCGAGTGGGTGGATGCAACATCTCCTAACAGCGGAGCTTTCCAGTACATGGGCATTGGAATTTCGCAGAA
CAAACTTTCGGTGAAATGGCACGAACCGAACGAAGCAGAGCTTTCGTTCGGATTTAACCTGCTGCAAGATCACGTAGTTGGAGCACTCGATGAGTTGGAA
CGCATGAGACAAGCCAAAAACCTAAATGCTCGTACGTGGACGCGCCTTCTAAATCAAGTGTTTCAGGGTCTTTGTGGGGCTGCAAACGTGCTGACTGATG
ACAGTGTCACGGAGGAAGGTGCGCTCTTGAGTGGTGCAAAGCTACTACTACTGAAGGCACTTGAGAGTAATAGGGATCTTTTCAAACAAATTGCGTCATT
GAAAAGCTCCCTGATGAGCCGCGTTCACGATATTGCTGTCTTTTGGAGAGAAAATGGGAGTAAAAGTGCGATGGAGAATCAGGTTTGGCGGCTGCTGTTG
GACATCATTCATCAGCTTTTAATTTGGAGAGGTGAACATCTTGACGAGTTCGGGATAAAAGAAGCTCAGAATTTGTATTCCAGACTTACGAGTTTGGA