Description :
From Genome Similarity Track
Location :
Scaffold_65:155324- 159783
Transcript NameFunction/comments
Phyca_LT1534126858TonB-dependent receptor
Phyca_LT1534126938syntaxin 7-like protein
Phyca_LT1534510705UBC-like protein

Sequence
4459 bases(100 bases per row)
gcttatctttaaacgcaaacgcaggaatgttcctgcagatcaagatgtgcggtctcttaagaacgccgtccttatgcaggcttcagctgcacacggcgga
ggaaaagaggctctcccagtactggaggaaggataccaggtcaaagctgatcacccgcgcaaggctgccgttgaaagctgcattgtgatcaaaacgcacg
cttcttcagcttgtgatctccgtttttcggatggtacgatcgcatttgaggtgtttccgtcacaaatgatcatcgacagcgtggagcatcagcgaactgc
caacactcacacaaatgaaacctccaaccgagcgcaatatacgccagtgtttgccgtcggagactacgtgcttgcttggagctcgcgctttggacgctac
tgttcagccaaaattgttgccaaaacgtctcaagaccctagtaatgggccagcatcttcatcgtctcctacagctcatgtcattgccatcgctgcagtgc
aaactgagctatacaagttggtattcgactacggcgagctgaaagctcacatgtcacccgataaaatcactactctggatgatatggccgcgttgtacca
tacacaacggttaaccaactacagcattgacacgatggggtttgagctctctccagtgagtttcaccgttggggaattggtcatgggccgcgtacatgga
acagcaagatacttcaatggtgtagtcgaatcggtggacgagaaagagcgagtctgtgcggtttgtttcgactcatcggagcgtgacactgcagttccct
tctctgccatgttttcgatcgactcaaggccacatctcgcaagcagaagttctagtaccaagcaagtaggaggtggcgctagttcgtcttcggaggcggc
gtcaagaacccaattcctttcacgtcaacgcagtacggaaactacagcaccctcagaagcaaactcaagacgtcgacgacacagcagttcatcaatggga
aacatgctcaagtctgtgactgataacttgttccgaagctcgcgatccaaaagaaaccttgacacacgccgaggctcgcacatgatcaccgaaattggag
ctcatctccgactcgaggaacagtagcgtccagtgttttcatgttgtagaatatagtgacagatttttttttcatttcaccaaggtatacaaccattatt
taagaaataagaggctttcactgcttccctgtcatttcctgttgagcgtcactatattcacaagacaatgccacaacgatgagcctcctaactccagcag
cagcgagattacttggcagcgaaaatgatgcccatgagggcgataaagataagcagcgcgaaaatggcgatgcaaatgagcttcatctttgagcaagcgc
aacattttctgcgctcgtccgcctgcttcacctgctcgagtgccttctccacgttgtccttggctgtctctgtattgtccacgatctcaaccaccatctc
tccctggtcctgtacaagtccatcgatctcttcgaacgcagcattcacctcgcgaagctggtgattaatctggatgatatcgtcctctctcctctgcaga
tctgtaaggcaaaaaaagtcgtcagaactctctcctcattttaattcacacaatcaacgcaccgtcttcatcgtaaatgaccacattagcctgtgcgtag
atctggtcctcactgtagttggtaaactctgcccctccacgcgtctgtcggccgttgctacccttgaaactctgcgaggagcgtcgaatgaattccaccg
actgtcgctcggactcgagcagccgttcgcacgtctcctcgaacacgcgcacttggttcttaaagtccgccgagagtttattcacctgagtacgtcgcgt
gcgtccagcagctcccttggctccacggttaagctcctgtagacggcggttgatcttcgccacgagtttatttcccttctctgtgagttctttgatctgg
ttgtggttggctcgtgagtcctgcggtgttccgaacagcgacatcttctgtgcgatgctgcgcgtgagctggttgaaggtcgagatgcccttactggtct
cgctgacgagcttgctgaatcgctcgtccgtcacgccgccgctgctgttgcgcggggactgagcactgcgataccgatcacccatggctactgtgtggag
aaggagactagagaacgaaccactgcgccgtggaagcgcaagagcaagagtgacggcgacggtctgcaggctcaatccagccagtttaaactgcaaagca
tgagggtgctgcacctgctaaacttgatatccaattgatgttagataggaggtttatcaatgtcaaaatacagttttgttgataaataagtgtagatgga
aaaatgcagcgtgatgtttttacctctgtaagctagagttacacacggcgagacgacaagtaaagtcgtgtttgctcgaacagctccatgaaaaatatcg
gcttgtggctgcggcttgcggcgtgggtgcctatagaggcgctgagatttgtgcggcagcccggcgcaaaacactgagatcaactgcatgaaaaagatct
cagcaaacgtcaacaggacggcaactgctatgctggtacacttgtacttttcaaccttgaaatcaatttcttaagaggtcaaatgaagtttaatgcgcca
gactggccattacgttttcattaccgaagcggaatgggagcacagatggaactcttaacgggatcacgttgaagctcgacagttgggcgtcaaggtaggc
tggactgcagctggtcagaacgacgaaggcaacgtaacgatgcaatttgacgagcaaccagtcggctcctgtctctgttggcggtgcactgcagtgcagt
ctgcaccgggtgcggaggctgtccctcgggatgtccctgatcgttgacaactcgttgtgtgatcgctaatgatacctcgcgtaaagcagcaaaagggggt
caccgagtcggtgaccgaagacactaacaatagaagttctccatgtagttccaccatgtacatgtattagctgcgatgctagtcatataatggctcataa
ttgagtcgtcttattgtttgtcaatgtaatcctgtacatgtatgatcgcatcgtgtgcagcattcagctcgatccgttatcctgtaggcttcgctaaaat
ggcatacatgtgcatgaacttcatgatggagtccgaccatcaacaggcttaccccggatgtgacgccttttgannnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntctaagttggcatacaacttattcgtg
cgcatgcactcgagcaccgctcgcaaatggtcaaggtggttctccacatcagacctcccgtgctccgcacgactatggacgaagatgtcgtcaaagtacg
tctgagcgtacgcccgatggggcctaaacaactgcgtcactagacgattgaacgtcgcaggcgcgttcgacagcccttggggcatcaccaaccactccca
gagcataccgctcggagtactcacagccgtgaggggtatatcgctagctctcatgagcaactgataatacccgtcgaccaagtcgagtgcactgtacaac
gtacatcccaccatgttgttctgcagaacatcctttcgaggaatcggcgtctgcgccggaatggtggctgcattcagcttattaaaagcatgcactatcc
ttctgagcttcggccagcaaccagcattcacgctgcaagatcaccatgcccagggtgtcctgggccaggaggctgtttttcaccaatccatgagctgagt
ttcgctatttttagcaaatcactatctttgggtcagaagattagggtatcactcgcttaagtccgagagcttcgacccgccaggcccgttctccgcaacc
gaagaaaaacttccagaagacctcttttgaacaacttctcctacaacagcatagtcatttgccacccgagttgcaaaataaggggatctcgcccccctcc
gccccagcagcttcgctgtcattatcctttcgtagcaggaagcagcagaagcggagtagagaggagaaggaccagaatcaaacatggctctgaagcggat
caacaaagagctacaggacctgggccgcgacccgcccgctaactgcagcgccggtcccgtgggcgacgacttgttccactggcaggcgacgatcatgggc
cctgaggacagcccgtacgccggcggagtgtacttcctgaacatctacttcccggccgactacccgttcaagccccctaaggtgaacttcacgacgcgca
tctaccactgcaacatcaacgccaacggcggcatctgtctggacattctgaaggaccag