Description :
From Genome Similarity Track
Location :
Scaffold_819:15530- 17474
Sequence
1944 bases(100 bases per row)
accaTCGTGCGAGTAGATAACcctgagttcatgtttgacacCGAGGGACTATTCGGAGTCTTTTGCGCGCAAGTGGAGGCGCTCGTTGGGCCTGCTTTGG
CAGCCTATaaagctcgaacacttcggCCATACGGTACGTAAAAGCCAAGTCTAGGAGCAGTGCATTGGCACCTTGTGGGCCACGAGGTTCTTCTGCGCTC
GGAGTTGTTGTATTAACCACAGATAACACGCGCAGCGACAATAGCGATTTTCTCACCGAGCGCACTGatgtgcatgttggtgaTATTGCGAGCACGCACT
GGGCATTGCCGATCCACATGCTgttgcaaagctctctgccGTGCCTGGTTTAATAAGAGATATCAACTTGATGCGACTAAACTCGGATTTTCCCTAGTAT
CATTAGAACCCTTAAATATTTTATGTCGAGTATGATTTATGGTGGAgatgtgcagttcaaatcccTGAGTTGTGGGCGATTGGtaatggacattctgacc
ggttttcacaatagAATCTATCCAATCCTTATTCATATCTAAATCTGATTATGATCGAAGCGTTTTATGGTCGATTATTCACATTTGAACCGTTAATAAT
GTCAAACTACGGACGCAGGACCAAAGAAGGATTAGGGCCGATTTATAAATATATCCGTTCGCAGAGCTGATTTATAAATCAATCGGTCTGAATATCTGAT
GCCTCGACGGCATTCAGAGTCCTGGTACAAATAAATCCGACACCAAGCCGCGAGCACGATGACTCTAGTCTTTCTGCCAAAATTGGGGCCATCACGAAAA
CGAGCCGAACCAATGTCAGCTTTGAGAACCCCAACTTCTCCTTCGACGAAGCCGAGTCGTTTGAAGCCAAGTGCACAAAAGTCGAGACGATTGTAGGTCC
AGCCCTAGTCTTGGTGCTAAACAGGTAGAGTGGGTATCTATGCTGTCCTAACCGTCGGGAGTGCCTTGCCATTCCCAGAGGCAATCACCACAAGGGTATA
ACGGACAAAAAGCCTTCTGTCCAAAAGCTGCTTGCTTTTGTAGCTATGGGACGtatgctcaagctgtcggtATTCGTCAGGCGACTGCATCTAGCATTCA
AGACACAGCACGCTCCATTGACATATATATTAGAACATAGAGGTGTTCGGGTTGGGCCTATTGCCCGTATCTACAGGGACACTTCACACACTAGACAACC
CGACGGTACTCAGCCAGCCTAGCTCCCGGCTCGGGAGTGTCCCGAGCCAAATTCTGCACGATTTTCCACTGAACCTACCCCTCCATTATCTACTGCTGTT
ACTAACTCCGATTATCTGTGAGTATCTCCAATGTAGACCCCGTCAGATGCTTATATTTAGTGCCTTCTCGCCAAACTCTACCTCCCAATAAGTGCCCAAA
ATCGCCGGACAAACTAATCGGTTTCACAATAAACGAACATGTCTCTAACGATGTACACCGTTTCGGGGTACGTCAATTGTTTTTCTTGATGAAGgtgtat
tgtgaaaaccgctTCGTTTGCCCATTTGACATGCAAATTGGCCGATTCGGACCCCTTTTATCGCGATGGATTTGTAAATCGCTCGCATATCCCTAACACG
TTTGAGCGATTAGTAGCGCATGCATAGAGATTAAACGGCTGCCTTAGCTCTAATCGGCCGATCTGCACGCCTATCAAGCAGAATGCCTATCTTCTGCTGC
GCAATATGCTCAGGCTTTTGCCAAAGGGGTATTATTCCATAAAATGGACAAAATATCCATTTAGAGATGAAAGCAACAAGTTCGAGCACTGAACGTCACC
AGCAGAGCGGATATTGCTACCAGCAGCCAGCATTAGCGGCTTCAATAGCATTGAGAGGCGAATTCGCTTCTCGGTTGCGAATATGACAGTTTCTAAAACG
CTGTAACCAGCGTTAATGCCTCAACTATCGGCGCATGTGGTACC