Description :
From Genome Similarity Track
Location :
scaffold_54:155286- 159583
Transcript NameFunction/comments
Plaha_PHALS_02195autophagy-related protein 8 precursor
Plaha_PHALS_02196WD-repeat protein WDR6%2C WD repeat superfamily

Sequence
4297 bases(100 bases per row)
TTATATAGCAGTGATGAGCTCTTTTAAGAAGGAACATCCGTTTGGTACGTATTTTGTAAATCTTTTCATGCTTGTGACGGGTCTTTATTAGCGATAAATC
GTGTGCATTCTTAGAAAAGCGTCAGGCCGAGGCTCAGCGCATCCGATCTAAGTATCCTGATCGAATTCCGGTAGAAGCTGCTATCTTAAAAGCTCGGTGA
TTCTTGTTGATCAATTGGCTGTACTTCTTATTCCACGAAACAGGTCATTTGTGAAAAGGCGGACCGGAGTGACATTCCAGATATTGACAAAAAGAAGTAC
CTGGTGCCGGCCGACTTGACTGTTGGTCAATTTGTTTACGTCATTCGAAAGCGCATCAAATTGAGTCCTGAGAAGGCCATCTTTATTTTTATAAACAACG
TTCTTCCACCTACCGGTACAGATTCAAGTTTATAGCGATTATATTGATCGTTGCTGATTCTCATTCTCATCTAATGATACGACTCTACTATGTAGCTGCG
TTAATGTCAAACATTTACGAAGAACAGAAAGACGTAGATGGGTTTCTTTACATCACCTatagcggcgagaacacttttGGCCATAAGGCTGCTCATGTTG
TCGGCGTCTAGGGACTGGATTttggcttttattttgtttTCATCGTCGCTATTGTGTAATGAGAGGCTCTGGCGCGTGGATGTGGTGGCTGTCATCATTG
ATCACTCAGACGTCGGCTTAGGATAATAAGGATAAAAATGCACTATCTTTAGCATGAAAAGAGTTTTTGATATTGCGTGTAGCTCATTCTTCATAGCTGG
CGATGTGTTATTCAGAAAGACTAACTCAATAATACATCCAATCCTGCTCATGTTTATAAAACTCATGGTCTCTACTAGCGCTGGTACTGCAACATCTgca
gcccttggccgacgaTGACAACGTCGTAAGCCATTCCAGTCGGAGCAAGCCGAGTCGCGAGATCAGCAATATCTGCGCACTCAGAGAAGGCCACTCCTTG
CCATTCAAGCTCAACACTGTCTTCGTTGACACAAATGTTCCATTTGCTCACTCGCTGATCATATCCAGCGGCAAAAATGACCTTGGCGTCAACGCAACCG
ACACTTTTGACAGCCGCACCGCTAGCATTTACTGTCTTGGCTCCGAAAAGAATTTGGCATGACGGAAAACGGAACTTGCTTAAGTACAAACTTTGGTCAT
CTCCACCACTGATAAGAGTTACGTcaagattttctccatccgaGCTTTTGTTGCAGGAGACTAGATCAAAGCAGTTCACACCCATGTCGTGAGCTATATA
ATTGCCACTAAGTTGAAGCTTTGTGATAGTATTTTCAAGCTTCTGCTTGTAGTGCGCTATACCTTCATTGGATCGAACAAGTATTGCAATCTCTTTCAAA
ACCGCGCTCAGATCCCACAGCATCACGAAGCCATCAGTAGAGCCAACTGCCAAACCAGCAACCACCGCATCGTcatcacaattttgaaagcCAACGCATG
ACAAGATCGGTTTTCTGGAAGCTAACTGGCAGTCACCGATCTCGATCAATTTTTCATGATCTATGTCTAACAGCAATAGCTGAGTAGAGCCTTCGGAATT
GCAAGCCGCTACAAGTCGGTACGCGTCTGAGGCCGAAGGTATCGCAAATGTAGCAAGCCCGAGAATGCGGTGATCCTGAGCTGCTTCAGCACGTTCTTGA
CCGCAAATCAGGCGGAGCAGGTCGCTATCCCCGCAAATAAGCCATACATTTAATCGCTGCTTGCCACCACCAGACAAAACGATATGCTCTAGAATACCAT
CACAACCTCTGCGCTGGAACGTTGTGAGTGCCCGAATCGTGGTTGTATGGGCAGTTCCTGTAGCTACGCTGGTCCAACGCCTACCCTTCTCCtggcgacc
gcaagagcgaCGACGATGCAGCATGAGCCtattatcatctgcagctgTGATTAAGCGATCATGCCCGATGAAAGCCACACAAGTTGTCATGCGCCCATGA
TGCTGATCATGTAATGAACATTTGGAGAATCGCGGATTGTGCTCACCAGGATCGATGCTAGTCAATTTGGTCGAATGCACCTTGACATCAACTTCATGCT
TTCGCGATGATGAAGGCGTAAAGACAAACGTATGAGAAGGTAAAGCAGACTTATCCGCTCTTGCACCAGTGAAAATTGCATGCGGTCGACGCCACCCGCC
GCATTCTACGTTGAAGATACGATATTGCGCGGAATAGTTGTATAAAACAGCTTGTGTCGCATGGAAGCCAAACACTAAAAGATCATGAGGTGTGGTACTG
TGGGCAGATGAGCCTTTGCTCCACAACAGCTGCTTGACGGTAGAAATTCCTCGAATAGACTCACGGCCCTTGAATTTGGCTGTCATCGCTCCAGAAGCTT
TTACGGTGAGCACGTACGAACAAATGTATCCGTCGTGTCCTCCGGataacaaaatggtgtggtgACTCTTTTTAGCATCAGTATGCTCTTCAGAAAGCAA
AATTGAAGCCACAAGTTGACGCCTGTGAACACCTTTCAGTACAAGAACTGGTATTTGGACTTCCTTGGACGAGTTGTCGCATTCTGTCGCACTGAACGAG
CGATGGAATGCGTAAATGTTACCGTGGCCGTCGCCTGCGAATACATTCCTGGTATTTTGGCGGTCTATAACAATAAGGGACGACGTTGAACTTTTAGCCG
GAATCTGGAATGTCTTTACATGCTTCATTGTGATCGCGAAAGACGGCAAATTTTCACTGGCTTCTGCTATAAGTGGCTTCCACTCACCGAGAGCGCCGTC
AGCACTGCTGATAAACACAGCATCCTCTTGGTCCCACCACATCTTCATAACACGAACATTTTTCTGAGTGGTCCATGAGTAAAGAAGCGTGCTTGTAGAG
GCCTCAACAATATGCACGAGTCCTGATGTCTCACCAAGAAGCAAGAAGCGTTCAGAATAATCCAATGCACAAGTTGACAATGCATTTGTTTTAGCTCGAA
CATTAACACTACGAGCAGGAGCCATACTATAAATGAGTTTAGCCACGAGTGACGAcagatcaagatgaaaaataTCGCCGTTTTCGGAGGCTACGAATGC
TGTCTTGCCATTGTCAAGGTCGCTAAGTAATATGTTACGCACACTGTCGGATGGCAAAGCTTTATTTTTCATTCCAGTGGAAGGTTTCGAAATCGGAATA
CAAATAGTGTCAAAAAATTCGCTAGCTTCAGATACACTGGATGAGGACATGAGCTGGTGAGTGATATCCCAAAGTTTCGCAGCACCATCGCCACCTCCCG
TAGCAACTAAGTTGAGCGAAGGGTGGACGGCAATGCGCCATACATTCCTACCCATGTGACCTTGAAGCGTTGCGACACAATGACCATTCCGATTCCAAAG
TTTGCAAAGGCCATCTTCGCTTGCTGTAGCCAAACCACGTTCCCAAAAGGCTACGTCCCATATACGCGCCGAATGACCCCAAGCTCTAAACAATGTAGTG
TATCCATTCGCAAGCAGTTCTGCACGATTTATTAAACTCGGCTTGTGCAGGCGCTCATTAGTTAATTCCCGATCGTGTGACCACAATTGCACAGTACGAT
CGTCCGAGACGGATGCCAAAAAGCGTGCATCCAAAGACCATACTAATTTTAAGAGTACACCGTCGTGAGCATGAAGCCGTTGAGCTGGTTCAATAGGCTT
GTCAGAAACCTCGTCTGCATGCTCCATTGGATTCCACAACAATATTTGTTGGAATACAGTTCCGGAAGCAACGACAAGGTCATCCAGCGAGCGTCCATGG
AACGCTAACGCATACAGGATGCAACGCTCAGCACATTGCAAACTGtgaagaatggtgttggaaatTGGATTCCATATTTGCACAAGATTATGTGCCAAAC
CTACAGCTGCCAGGACATTTCCGTCGTTAATTGTCGAAATGTCGTCTGTCAACAATACCACATCGAAGACCCAATCGCAAAAGACTTTGGGCTTGCCCAA
CACCTGAAAGTGTTCAAGGCCACGAGCAGCATCGGGAGTTTGCGGCAAGTTTTGGAAACAAGCAACACGTTTTTGACCGTAAAAAGCACCAACAAACGAT
TTGGATGTGGTGGATGAGACTGGAATGTCTGTAATATCGCAACCGTGCAAAATGCCTCGCATCAAGACATTGTGATCACCCAAAAAATCGCAGTCAGTCG
TGGAGTACAGGAAAATCACTGGGCCTACGCCTACGTAAAGTAGCGATCCGGTTGATGAGAATGACACGAGCGTAACCGAACCCAGGAACTCCTGCTT