Description :
From Genome Similarity Track
Location :
Scaffold_455:15526- 17576
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_455-snap-gene-0.16Transmembrane protein

Sequence
2050 bases(100 bases per row)
AAATGATGCGAAGAAGCGGGCCATACAGAATATGGAGGATCTGGAGTGATGTCGTGGTGCGATAATCGTTTGCCATCTGGAACGTGTTCCCATGCGCGAT
GTAGCCTCCGACAAAGGACGTAACGTCGTTCACGCGCTGGCTCTCGATCGCCCATTTCTTTTCGCACATGAGGAACACATCGTCTTGGAGCCACGCCGCT
GCGATGGCACCGATCGTGACGATCTCTGGGTTTGTGATGTACGTGCCCTTGACAAACTGGAACGCGCGTCGCTCGTTGATTTTCACGAGAGTACGCCACA
GGAAGTGCATTGCACCCGAGATGAGCACCCAGCACTTGATACTGCTCAAGTACGCCTGAAACTTTTCGTTGGTTGAGTCACTCCACGTCCAGACGACCGA
GTTCGGCAGGATAATGATCCAAGAGATCACTCGCGTGAGTCTCATCAGCCACAGGTAGTTCGTATGTTTGTAGAATGAAGCACAGAACAGCGAGTGGAAG
CGCTCTTCTTCAAGCACCACTGCCCCATGAGACGCCTTGCTCTCTGGAGACGATCCAGGTGCGTGGATGATGCCATTCTCTGCAGTTTCAAAGTCGCGGA
TCCACTGCTGGAGCGCGCGATACTTTGGCCGCAGCATCCATTTGACAATTTCATCGAAGCTGTAGCAGTGAGTGAGCAGCAGTGCAATATCAATTACAAC
CATCAGCGCATAGATGGGGCCAGTCGAGCTGAAGTTCATCGCTGTCTTCGATTGGATTGACGTCTGGTTCAGGTCTTCGTTGTAGTCGATGATATACTCG
CTGTGGGTGTTCTGTCGAATAGTGAATCGCTGCCCGAGCACAGAAATATTATCGTTTGTGAGCCACCCTTTGCCATACAACAGCTCTCGATACTGTGGTG
CAGCAAATCCGACAAACTCGCTTCGGTACAGATTCGGGCTTGCACATCCGTACAGAGTCCCTGTGAACGCTCCAGTCACTCCCTCGGCGAGCTCAAACGC
TTCGACGCAGATCACTCGATGCAGTGGAATGCTCGTACCCAGCATGTCGAGAAGGCGCAGGATTTCTGCTTCGGCGTCGCTCTCCAGCGGAGCCACCGCG
GAATTATTTACTTGTGCCGCGAAAAAGCCGTATCGGTCGTTAAAGTGGGTTGCGATGTGGTTCTGGCAAATCGAAGGCCTTCGACCAATATGGAGAAGCA
TGCAGCTGGCCCAGATCAGCGCATCCACACGGAGGTTGCTGGTGAGAACCAGCTGTGGTATCACCTTCACCTTATCGTTGCTTGATGTTGCAGGAAAGTG
GCATTTCTTTGCCAAGGCACTCAGGAAGAATGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGCCAAATGCGTACATGTCTTCGCACTGGGACAAG
AACGAGCTCCAGCCCGAGGCAACGTCCTCTCCTGCGTTTTGTGCTCTGACGTCGCGAGTCACAGCAGACACCAGCGGTGTCGTATGCAAAATGCTTGTGC
TTCCCGCTTTAAACGAGAACGAATCCATCGGTCCAATCCACGCAATCTTGTAGTAGAGATCACGGACGTCGAGACCAAATAGGAACACGACGAAAAGCAG
CTTCTTGACCATAAACAGCTTCGCGTTCACCTGCTGAGTCTTTTCGAGCCATGACGTTGCAGTGCTGGGCTGGAAAGGCGGTGATGTTGCAGCCTGTGGT
TTCTCTAGATGAGCGGGATCTGGTGGTGATGGCTCGGGCATTGTCGGCGGCGATGACTACGATCGAAATCGTCGAGTGCGCTTCGCTCTCTGTCAAGCAC
AAAAAATACCAATGCCAGGAGGACGAATATAGCGCACAATATTGAGAGAACTCGGCCACAAATACCATGCAGCAGCTCGAAATAGTAGCTACTACTAGGG
TGTTATCCTTATGTTCATTCACTTTGTTACAAGGTGATTGACGCACGAAAGCCGATCTTTTTATCAGTTGGTTGCACTTTCTCAATTAGCACTTCTCCAG
AAAATATATATAAACCTGATTCTGCTAACAATCCATTAATTGTTTTTTAG