Description :
From Genome Similarity Track
Location :
scaffold_38:155177- 157551
Transcript NameFunction/comments
Plaha_PHALS_04759hypothetical protein
Plaha_PHALS_04760hypothetical protein

Sequence
2374 bases(100 bases per row)
GCGGGAATCAGGATTTTCGCACTATTCGCCAACTTATTGCGTTTGGAAATTTAGCGCAAGTGCCAACTAGCTCATGCAAATCATATAACGAATTGAATCA
ACTTACCAGCACAGATTCCGACTCCCGGAAAAGATTTCTTGTTAAGGAACATTTCCGTGTGCACGATGCACATTTAGTTTGATCTGGTATTAGAAAGTTT
GATCTGGTGTTAGAATAGTATCAAATCCGGATGCAAGAATCAAACATCCCACCCATAGCACTTCGTGATGCGAGGGCCTCCGGCAACTTTTATTCACTTT
GTCACATGGTTGTGCGAACCCATACGTGCGCTCGTACATACGTAATTAGACAGTAAATTCGTTTATGACAGAATTAGCGGCTATCGGGGGCACCAAAGCA
CCTTTGTCAAGTGTTTGAGGTCCTGGAAGCAAACAAGCTCTATTATAACACCGAAAAATGCGGCAGGGTATTGATGCCCACTAGTGCCTTGTGATCAATA
GGGAAGGGATAGAAAGACCCTGTGCACTTAAGATCCAATATTGTTGCGTTTGGAACCCAGTATCGAAAGGACCTACGCTTGTGGTTAGGACTGGCAAATA
ATGGAAAAGTACGGTACAGATTATGCAAGTCTTGCGAAGCCATTGTCCGGTTTGTTGAAAATGACATGGACTGGTGTCGGAAGCGACTCTACCAGAATGC
ATTTGGGGGAATTAAGGCGAGCTTACAGCAAACGCCTGTGCATGTTTTGTCAGACTAGGCGAAACCTATGACTGTTGCGTATGACGCTTCAGATCGTGTC
ATCGGCTTCGTTATTGCGTCTGTTCGAAGTGGAGCGAAAGCGAGTGATCGTAATACAGTCGAGGCAGCCCATGGCTACCGAGAGGGGCTTCCCCAtccgc
aaaaaaaattctcgATGAATACACGCTCGTAAAAATGCACCCTATTGCTCTATTGAACCTTTTGTGGTCTACACATACCACAAGCTACAATTGTTGCGAC
AAATATCCAGATGGATGAGTTTCGTCGTAAACGCGTTCGGGCAAGATAAATATTTTGCCAGAATTTTATTGAATCGACAAGGCTATGAGCTGGCGCATAT
TGGTAGGATCGCAGCGTAATCAATGTCAAAATTCGTCAGGCGTGTAAAAAAGGCTAGTTCAAAGCCTTTGCGTCTACAGACGAATACGTAAGTATTAAGT
GGCTGAGCGACGAACACGGTTTCAATCCCATCTCCACAAATAAGTTAGCAAACATCACTACTGTAGAGTAAAGCAGAAGGATCTTTCAAAAACTGTCGTT
TCGAGCGACGAGGTTCTGAATGCGCTAAGCTACTGAGGTTCCATGATGCGCTCATCCCCTGAACTAATTGGGCTGTAATTATTTGGATTCTCAGCGCTTG
ACGCGGTCGCACATGTACAATAATCATTTACATATGTACGGGAGCGGAATGCGTGCTGCTTGGTTAAACCAGCAGGTAACGTGTCAGCTTTATTGCGTAG
CTTGTCCGTTTCAACGGACTATTGGAAATCCGTGTATCTTTGCTTGTTTTATCAACCGACACGAAAAAGCTTgcagacctgcaaaaaataATATGCCATG
TGTTCAAAATGGAAGATCTTGCTCCAGTATTCACCGAGACGACGGAAAGCAAACAACCGGGCAGTATTAAATGACAAATTTCGTCATCATGGCCTGCCTG
AGACCCGGAGTTCATTGCTATATTTGCTATAATTGAAAACAAGTTCATTGCTTCGAAGATGGGCTTTTGGCTTGGGGTTGTTGATGTTCACAGCCAACCA
TTCACAGACAAACGATCAGACTGAGGAGGAGATCGAGCGATCGAAGACACACCGAGCTTTttatgcgctgagacgccacaCATGGTCCGGGTAGTTGTCG
ATAATTGAGTGGGTACCCAGCAATGCGACCCACGCATTAATAAAGTGATCTCTCTTACGTCAATAGATTCGGGCACGAAACAGTGCGCACTGCACTCATA
GGACGCATGGTGAATTCGACAGTAGGTGGAGGAGGTCCAAAAAGCGGTATTTCTCCAGATCTCGTACGCGAGACCGCTTTCTTTGCAAAACTAGCCGTCA
GGGTGTGATCAGACAGGCCCTCCATGCAATGACAGGGCTTTAGTATGAATGAATGATACGAATGGTATTATATTTGTTACGGAAAATTAGACTATTTTAC
ACACTCTAAAACTTCCTTAAAATTGATTCGTTTGTTTGAGAGTGACAAATTGGAAGCAGTTCTTGTTGATCCATTTACGGTCCTGGGTTGTTATGGGCCC
CTTAACTAATCAAACGCAATAATAACCTATCCAATATTTTGGGTAGCCTCAAAAGTACCATGATTCCCTGGATT