Description :
From Genome Similarity Track
Location :
Scaffold_4:1551745- 1574171
Transcript NameFunction/comments
Phyin_T30-4PITG_03379Putative uncharacterized protein
Phyin_T30-4PITG_03380Putative uncharacterized protein
Phyin_T30-4PITG_03381Ferric reductase%2C putative
Phyin_T30-4PITG_03382Putative uncharacterized protein
Phyin_T30-4PITG_03383Ferric reductase%2C putative
Phyin_T30-4PITG_03384Putative uncharacterized protein
Phyin_T30-4PITG_03385Putative uncharacterized protein
Phyin_T30-4PITG_03386Putative uncharacterized protein
Phyin_T30-4PITG_03387Putative uncharacterized protein
Phyin_T30-4PITG_03388Lectin%2C putative

Sequence
22426 bases(100 bases per row)
CTATTGCTGTCACTGTTCCTTTGTCCATACACTCACGAAAACAAGACCCAAACGCCTTAAGTGAAGCGATGGAGGTAGCCGTCGTCTCCGAAGCTGTAGT
GTCCGAGGCGCTGCATCAGCTCTATAGTCCTCTGAGCTCTCCGCTCGTTCGTCGACGTGCCGATTCACTGCTACAGCAGTTTCAGCGCTCTCCCGAAGCA
GCACAGACGGCTCTGGTCGTGCTGCAAAAGCCGATTGTCGACACAGGCAATGCCGAGCACAACGCCTTGTTACGAGCCAAACGCGCGTTCTCTGCGTCGA
CACTCTACTTTACTGTGGCTTCGTACATCCGCAAGTACAAAATGGACGACCCAGCCAACTGGACACCCGAGGATCGCACACAGCACGAGCTTGTCGTGAA
GGAATTTGGTCGGATGGCTCAGGATGTCTGGAATGTTTTAACTGGACCGAATGGAACCCAAGAAGAGCTGAACGTGCAGACTCACTTGGCCCTCACGATT
GCAGTCATCTTGCTGCGCTTCCACGAACCGCAGGGCGATACCACTGTGGTTGGTGCAGTGGAATGGCTTGTTCAAACCCAAAAGCACCCGGTGAGCGATG
GTGTCACGGCTGTATTGACCAATTTCGCTGTGCTGCTCACGTTAAAGGTTATTCCAGAGGAAGTGGACAACAAACGCGTCAAATTCTCTAAGAACAAGCG
AGCTCAGTGCGAAGATATGGTGCAGCAATGCGCAGCTCACGTGGTTCGTGACGTCCTGCCATCAATTGCCACCGCCCTTGATGCCAGCGAAGAGCAGGCT
CAATTGAAGGGGCTTTTGCTGCAAGCGTTTGCGAGCTGGGTGGAGCATGGCACTGTGCCACCTCCAGTCATCATCGAGTGTGGGTTATTGGATCGAGCAT
TCCGAGAAGCCTTGGTGCCAGCAACCTCCGTGTATGCGTTGCAGGTTGTGCGTGAAGTGGTTCGCGCCTGCCGTCACAATGAACACGTGCAGCTGATGGA
GATTGTCATGCACAACTCTGTGGTTCTAGGAAAGCAAGTGCAAGAGCGCATAGCTGCATCCGAGAAAAGCTTAGACTATTGTCTTGCCGACTGTGTCAGA
GCAATGTCGGAGTGCGGACAAGCCTTTATCGTGTACTTTGTGGATTATACGCTTGATATGCGCCCCGGGTCGTTGGTCTATGAATTCCTGGACTCCATTT
TGTTCTTTACGTCGCTGAACAACCTCGACATTTCGAACGAAACGATGGAGTTCTGGATCGATTTCCGCGCATACATCTCCGGAAAGCACGAGGAGCGAAT
GTACGTGTTTGAATCCTTCATCTCGCGATTGCTCATCATTTTGATTGAGCGGACCCAGTATCCTGAGGGCTTTCAGGCCTTCCCGGAGACTGCTAAGGAG
CGTTTTTTCCTGTACCGAAGTGAAGTCCGCAACGTATTCCGTGCACTTGCAACAGTTACAGTGGCTAGCGAGGATAAGTTCATTGTCGATGCGATTCATG
CCATTTTTCAGCAGTACGAAGCCGCCGATTCGGGATCTCCCTTGCCATCGAATGTACGTGTGCTGATCAATTACTGTCTGCAATGTTTCCTACGCTAACT
CCTTTGGTATTTGTGTTTAGTGGTGGCAACGAACTGAAGTGTATGTTCATGCTCTTAGTGCATTATCAAAATCGATTCGCGAGGCAGATACGTTTCTCGT
TCCGAGGCTGTTCGAGTACTTATCGCGGAAGGAGCCTTCTTACCGCGCACTCTTGCGCACAGTCACCATCTTCCTTGGCGTGTCCGGCCATTGGTTCGCA
CAACATCCAGAGCACTTGTCAACCTCCGCGTTCAGAATCATCTCCAACGGCTTCGAGTCTCAGGATGACCCTGGATACCCGTTTACTCAGCACGGCTTAG
AAGATCATGTAGGTGCGGTGGCCCTCCGGAAATTGACTCTTCGTTGTGGCTCGCACTTCTTCAATCCGCTGTGGATGGACGCGTTGGTGAACCTGTATCG
CTCGAATCGCGCGGCAGTGGGCGGGCCGTCCGGGTGTTTGACGGGAAACAGTGCAAAGCTAATCGTCGACTCTATCTGCCACGTCCTCACTACTGTATCT
TACAAGGAGGCACTCCCAGTGGTGGAGGAGCTCGGTGCCATAATGTTTGCAGACCTTGCTGCTCGGTACAGCCAACTAAACGCAGACGACGAAGGCTCGG
TAGAGTTCCTGTGTGAAATGTTTAATCATCTCTTCGTATTAGCTACGAGGATCCCGGTGCTGATGGACCAAGAGACCCCGCATCCAGTTCTGTGCGTGTT
GCAAAAGCAGTGGGAGGTGTTGGAGACTATTTTGCGAGTGTATGGCTGCTGTGATGAAGTGGCGGGGCAATTCTGCGTGCTTTTGGTGGGCGTGTTTGAA
TCTTTACGGTTCCAAGCGCTGGAGTTGGCGTCTGCAATCATGCCGGCGTTATTAGAGCAATTTTCCCGGAGTTATGATGGTAGTTATCTTAGCGTGATCA
AGAGTATCATTGGCTGCGCTGGCGACGACGAGGCTACTGCAGTTAGCTTAGCACGAGTGATGATTATCGTGACTGAGAGCTCAATGAGCAAGATCGCGGC
AGACGGTAGTGTCGACGAGCACCCGGGACTTACTATCGCACTTTTTTCGTTGGTGATCACCTGCGGTACCCACCATCCGTTGATCTTAGTCCAGTCGAAC
CAGTTGGAAGGTGTTTTGGCACTCGCGCTGCACGCCTTTAAGTCCCAGAACCCTGAGGTTGGAACTGCAACTTTAGACTTCCTGCTTGAGCTGGGCTCTT
TATACGGTCAGATCCTTCGCACTCCGGAAAACTTGCTACAAGGACCAGAATTTGCAGGAAAGCTACTGCTGCACCAACAGATTCAAACTCTATTCTTTGA
GAAGGACGTGCAGTACCACGTTCTTTTCGCATTGTTCAATGCCGCGGCGGGTGGTATGCCACCAAACTTGATGGAGAAAATCGCAGAAGTCGTTCGGTCT
TGCTGGGTCTACTTCGGGCGACAGCGCAGTGAAGAGCTTATTCACCGGCTTCTGTCCGACAGCAACTTTCTGGGCTCGCAGGTTAGTGAACGCGCTCGAA
CTGAATTTCTCAACTACATATCCACACCGACGTGCGCGGAAAACTCGCGTAAGTTTAAGCGCGTACTGAACGCGTTCTGTGACCACTTCAAACGCAACCT
TACGGGAAGTGCGGTGCCATCGTGATAGAGCTGGGCTACCGAAAATGCTGCAAAGGCACAAAAAAATGAAAAATGAGGAGCTGTACGAACGAGGGGCAAA
GCCAAGCAGCAACGCTGCAACCAAACACAAACTATGCAAAAACCAACGAAAAGAGACAATAATTCACGCGGGCTACCAGATATTTTAGGGATGCGATGCA
AACAAAACGTAGGCTTCGCTATTTTGCCTTGCTAGTGAGCCAAACAATTTCGTTTCTATTGAAACGAGTTGCCAACGTCTTTCCAGGACGTCGTGTTGTT
CACCGTAGTGGCAGTGACCAAATGTCCACTTGGGGGGCGAGCAGCAGAAGGAGTGTTCGACCACTCCAAAATCTTCTCCGCAATATCCTCTGCCTGTAGT
CGAATTCGTAATGCCGCAATGTGAGATTGTGCGGACAAATAATATCACCAAACATTTGTTACCTTTGTCCACGTAGAAAAGTCAGCATCACCCATGAACT
GTCGGTTCATCGGCGTGTCGATCGTCGTTGGTAGCACGCCAAGCACGGATGAATCCCCGGGTAGTTCAGTTCTGTAATTAGACAAATATAATGAGCGTGA
AGCTCTCTTTAGACCAGGACAATTCTTCTAAATCCTTACACAGCACTGGCAATCAAATGGTGAGTAGCTGCCTTGATCGCTCCATAAGAGACCATGCCAG
GAGTAGCTTGGAGGGCCGCAGTTGCGCCTGTAAGAATGAGAAGTCCGCCAGGCACAAGCAAGTGGCTCGCCAAGTACGTTGCTGTAGAACAATTGACGCT
CCGTCAGCAACTTTAACATAGACTCAAGTTGAATCCTCATTCACTCGCCCAGGAACGCAGACTCGAGGTTCTTGGAGTACATTTCTCCCAAGTTGAATAG
CGAGTCCGCGTCTCGGATACTGCCGCCTGCCCAGCCCCCGGCAGTGCACACAATCGTGTTCACCTTGTCATTGCTGACCACCGCAACACGTCAGCTTCAG
AATGCAAAGAATTGCATCAACATAACTAAGGAACCTGCTGGATATTTCCTTCAACGTCTGCTCAGCCTGTTTTAACGAGTTGCTCTTCGGCAGCAATACG
TTGTTGGAGGCGTCCTCACTGACCGAGAAGTCCACCGAAGTGACTCTCCATGACGCACGTGTGAAGTGGCTGACCACGCCGCGACCCAGCGCACCAGCAC
CGCCAATCACTAGCAGCTTCTTGGACATCGTGCAGAACGTTAAATGCGCGTCTTGAACAGGTTGTGTTTAGACGATGTAACATTGTTAGCGTCTAAACAC
AATTTGCAAAGAAACCTAAAGTGTACACGTATTTTGAAAAATAGATACCGGTAGTACTACTATCCTTTAATTAAGAATAGTAGTACGTTGGCAGTGCCTC
AAAATAATTACTACTTTAAGTAGTACTAAAGTTTGTAGTACTACAGTACCGGTATGAAACTTAGAATTTTCATCATAGCGTTCTATTGGAAGAGATAGAA
TAAGGGCTAATACTATTGACATTTATGTTTTTTACATTATGTTTTTAAACGAGCTGTCTTTCAATCGACAGCAGGACATCTACTAACGACGTATATGTGT
TTATTCTATGAGAATTTCTCCGAGTGGAAGTCGAAGATGGTTCCGTTCGGGTCCGATGACGAGTATCGCTTGCACGTGGTGTCCAGGATCTCCTCGAGTG
CGTGCGGGCCGCAGTAGAATACGCCGACCTCTTCACCAGGGTGGTTCGCCTTGGCCTCGGAAAAAACTTTGTCCCAGTCCGGACGGCCGAAGTGAGTGAG
CTGCTTTGTGTTCAGACCAGACACAAAATCCTTTCCTGTCTGCTCGTGCACAAACTCCTGGAACATCTTGAGCTGCGACGTGTTCTCGCTGCCCTTCACC
GTACTCAAGTACTGGTGAGTCTCGATCACATTATCACGATCCATTTCCGAGATCTGGTTCATCGTTTCTTCGAACCAGCTTAGGGACTCCTGTCCACGGG
TTACCCAGTGGAAATAGAGCTTTTGGATCTTGAACGAACCCGGATGCCGGACATGGCTGCAGTTCGGGCAACGGTTGTCTTCCCACAGATGAACAACATC
CTTCAGAATTGAGGCAAACGGGGTAACACCAATACCCCCGCCGACACAAATGACGGTCTTGTAACGGTGGTAGTCCTGAGTCGGAGCGCCAACCGGGCCA
TCGAGATAAATGTCGGGGTACAGCACCTTGCGTTCGTGGCAGTCCGCGATGACTCGACCCAAGGCTTTAGTCCAATCACCGCAAACACGAATGTGAACGC
TGATGTAGTTGTCTCCAGGAGCGGACGAAATCGTGAACGGATGCCATTCGTGAGACGAGATCATGGGACAATTGACGAACATGTACATGCCGGGACGGTA
TACAAAACGACGAGGCTTCTCCATGAACAAAGCTACTGTGCCGTCAAGTTCCATAGCCTCCATGATACGCACGGGTGCAGCAAACATCTTAGCGTAGCGG
AAACGACGCTCAATGAGGTAGATGAGGAACGGAGGCGTAATCCAGATGTAGGAAGAGGAACGAGCGAGCCATGAAGCAGCGCCATGAAACGAGAGCACAA
ACAGAAAGGGTCCGAAGAGCATGTGCGAGTACCAGAAGACGTTGAACTTGCCCTGACGGAACTTGGGGATCGCAGCTAGCGGGAACGAAATGCACGTGAT
AATAAGGAGAATCGCACCCGTCCACACTGGAAGCGACTGCAGCATCGTAGTGAACGGAGGTCGCTCGCCATTCACGAATGAAGACACATGGCGGGTGACG
AAGATGGACCGCTTGATCTCTTCAGGAGTAGCAATGAGGTACAAGTACACCTCGTTGAAGACGTGGGCAACAGTGTGGACAAGGCCAGCTGTAAGCAGCA
CGCTCCCTGCTATCTTGTGGAACGCGATACTGTCGTCAAAAGGGATGTAGCGCCATAAGAAACGACTGCGCTTCATCACTTGTGTGATGGAACGACACAT
CGGCAGCAGGACGAAGACGCAGTTAACCATCACCACTTGAGCGTTGGCACGGGCGATACGTAGACCCCAACCGATGGCGGGATCCACTTCGTACGCGAAC
CACTTGAGCCAGAAGGCGATATTGTTCACAATGGCGTATACCAGTAGCCACCAGATGCGGAGCTTGTTGGCACTGTACCATGCGCCAAACTTGCTCTTCG
GCCGGATAGGAGCTGTGTACATAGGTTCGGATTTCCGGAGATTGTACGAGTCGTTGATGTAGGGGGCGAACACCGTCTTGAACTGCTCGTACGTCATCGA
CTCGTTCTTTACTTGAGCCTTGCGAAACATCAGGTTGGCCACAGTCTTGAAGTCTGTGCCCACCACGTCAATGTGGGCCGCCGAAAAGTTCGATTCCAGT
AGCTGAACAATCTGGTCTTCGATCACGTACCCAGTATTGTCCGGGTCGAGTGTTTCGAAGATGAAACGCAGCTTCTCCTCACCGTCCACTTCCAGGTCCA
TCACGGCGTCAATCAGAATGGCGTTACCGTCGATCGCGCCGTTGTTAGTTGCATAGCCATCGAACTCGTTGCCATTAATTTCAAACGCCTGCGAAAAGGT
TTCACGCTCAATGAAGCCGTCCTTGCTGGTGATGCTGCTCATAACGTCGCGCAGAGCGTGCAGCTTCTCCATGGGGGTGTAGGCTGGGTTGTTGCTGTGG
ATGACGCTCTCGTCCATGCTCATAGCCACGTTGTACTTCTGCTCGAAGTTGCAATCGCCCAGGACTGGAACGGACACGACGTCGCTGCCGGGCTGCGGGC
CGTATCTCGAAACGGCGAATGACGACAAGTTGGATGCACGTGCCAGACTCTGGCGCACCATGGACGCGCCTAGCATTGCCTGGACGTTAGGGCGGCGGCG
GTGCATACCACGACTACTCTTGCAGTTAGAGCTCATCGTGGGCGGGCCGCGTCCTAGGAAGTGTGTGGTGGAGGAGTTCATGTTTATGAACTGGCTGCTG
TCCATGAAATTGGCTGTGCTGTGGAACGAGGATATCATTCCGGTTTGGCTGGCCATGGGAGGAGGAGGAGGGGGCGGAGGTGGGGCCGGCATGCGCTTAC
TTTTCATGCTGCCTTTCCGGCTAGCCGTGCGCTTATTGCGCGAATTGGGCGACGGCGTAGAAATGTCGACGAACGGCTGCGTATTCTGCCCGGGCGTGAT
CTTGAGCTCCTCCGCTGGAACGCGCACGACGGTGTCCTGCAGGCCGTCGCCACTGGTGTCGCCCATTTGGAAGCGGTGCTGGCGGCCCATCGTCCACCGA
AGTGCCTCGTGTCCTTGCGAAGGCGAAGAAAGCGAAGTGGCGAATCCGAGCGTGCGGTCACGACGATGAGGTCAGTAGGAGTCCACACGCAACTGTCTTA
GGGACGTATGATACGTCGTATCGTTTTATCTAGAAACGCGCTGGCACCTGTGCGTCAGGAATACAGGCAGGTGGCACTGCTGATGGCGTTGCAATCGCAA
ATGGCAAAGTGTCGGCGTCCGAGCGTTGCTAGCACCTGGTCGGTGCCAAGCCCCATCCGTGACACCTTAGTAAAGTTCAGGCCCACCGAACATCGACATG
TTGGTTTCAGTAAGAAATGTTCCGTTTTCGCCCGGATTCGCGCTGACTATGCAGCGGGCAGGGGGAATTCGTTTTTGGATCCCAGCTGGCCGATGGCTCA
GAGGCTTTTGAGTCAAAACCTCTTGAGAATCGAATCAACTCGACCGCAAAGTCAGTTGACTTCCAGTTACCGTTGATTTAGTTAGGTTCAGTTGAAGTGT
CATTGCCGCCCCACTTAAGGATCGGCACTTGTTCGGCCACAACGAATTCGCGCACGGATGAGGTTGAATTCGCCGACCAGATCTCGCTGTGTACTGCCAG
TACTACCGGAATGCAACCTGATTCAAATGCAAATGGTTGGCGCTGCCATTTCATTTGCTGTATACTAAAACGTTTTTTTTGTAATCGTCCCGTAGGGGCA
GAAGATTCTGAGTTTTGGATCATGGATCAAAGCCAGCTACAGGTAAAATACAAGAACATGGATTTACGACTTGTAAGTTACAAGTACTGTCATTCGGGCT
GCAAATGACAGCAGAGTTCTTGAACACAGTTATCGTCTCTGGGTCCGCCCCAAACGACAATCGATGTTCATAGACTATGAATCATAGTGTTGTTAAATGC
TCACGCTAAATCAATAATGTACTGTACTGCATAGACATTTTGCAAAATTCGGCACAAATTGCATTAGCCAGCAGCGAAACGGGGAAAGTCGTTAAATGCA
TTGCAAATTGCAATCAAAAGCTTGATCGTGGACCGGTATTATTACGGTATCGCCGGAATGCAAGTTGCATTGCAACACTGTTGCCGCAAGTTGCGCCAAG
TTCCAGCCCGAGATCCTTCCTGCGATGTGTTGCCCGCAGGCTGCTTGCAGCGACGAGCTCGTGAGGACATTGCAGAGCTGTCAACAATTCCACGAGATGA
CATTCCTTTTTAACAATACGTAATGCGTCATCTTTGTCGAGGCTGTCCCGGGCCAAGCGACGGCTTATTAAATAATACATGTACTACATGTAGTACATGT
AACCGGTATTAAAAAAATTGGCATTCAACTTTTCCAGGCATGGTATTTTTAGAATTGTGTTCCTTTGACTAAGAATGAGTGGCGATTACATACTGATGTT
TTGTAGGTGCATCAAGATTGGGCAAACGATGTATTAGTACATTCGCTTAATTCGTCTCCCCTGGTAGAATAGAATTTCCTGGCACTTCTGAAAACTTAAA
AAAGGTGTTTTGTAGTTTTTCTAAGCGCAGTTCTGCTAAGTTACCGTGTTTTGATACTTATTATTTTAATAATTTATTCGACGCTCTGCTGCTAAGCTTT
TATAATATGTACTACAGTGCATGCTCGGTAACCACCAGCGAATGCAGCGCTCTCTGCGCGCAATGGATCTTTGTCTCTTGAGTGCGACGTACGTTACTAA
AGATCCTGTAAGGTCGTACAAAAATTCAGGTAACGACTCGTGAGCGCGATACACCCAGAACTTGCACTGCTGGGCCAGCAGTGCAAGTTGTCCCTATGCA
GCTTTCATGAGTCTCACCGTGAGTGTGTTTTGTTAACGATGCCGCACAGTAAGAAACAGCAAGCGCAACATGTTTTCCCGGAACTCAACTACATGTAGTG
AGAGTAGCCAAATGCGCCCTATACGTTATCAGCAGGTCAGAATTTAGTTCTAGCCTCTTAGATTTAAAGTTTAATTTTACGCATATCGATTTCCGTTTTA
TAGTTAATATGGATTTAGCTTCGTCTTCCCACCTCTTATCCCACTGATAAAGCTCTCTTGACGCGCCCCATGGTTTGTCGATTGTTGCTGCTCTTGCTAG
CGACCTGCCTCGGCATTAGCGCGACTGGCAATGGCCTCCCCACAGCTGTGCGCCTGGTGACCATCCATCCGCATAACGTCAGCGCCTTCACGGAAGGGCT
CGTGTTCGATGATGGCGCGCTCATTGAGTCCACTGGACTCAACGGCGCGTCCTTCATTCGCAAGTATAAGCTGTCGGACCTCAACGCCGACTATTTCAAG
ACCGGTGCCACACACGGCGTTCCCTTTGTACAAGAATTCTGCTTCGACGCTTCCATCTTCGGCGAGGGTGTGACCGTGCTGGGCGACAAGCTGTTCGCGT
TGACGTACAAGGCGGAGCAGGTGCTGGTGCTTTCTCGACGTGACTTCCAGCTGATCGGTCAATTTCCCCTCACGACATCCACTAAGGAGGGCTGGGGACT
CACAACCGACGGGGAGTTCCTCATTGCTAGCGACGGCTCGGCCAACGTGCTTTTCTTCGATCCTCGCGACGACTTCAAACTCCATCACAGCATCACTGTG
CGGAAGGATGGCAAGGAGGTGACCAACGTGAATGAGCTAGAATATGTTGAGGGTGAACTGCTCGCCAACGTGTGGTTCGAGGATCATATCCTGCGTATCG
ACATGGCGACTGGAGACGTGCTGGAGCAGATCGATCTTGACTGGATATCTAATATGGTGCCGAACATTCACACCGGGGCTATGATGTCCTCCCCTTTCAA
GCAAGATGCTGTGATGAATGGGATCGCCTACGATCCCGTGACACGACACGTATTTGTGACCGGCAAGCTCTGGGACTCTATGTTCGAGCTTGAGCTGTCG
TATCTAAACACTCACAACCGTCCTATCGTCCCTTAAATCGTCTGAGACCGTGGATCTTATTATTATCAACCATCAAGTTGCTGATTTTACACGGGGTTTA
TTCATTGGGGCCACAAAAACAACAACTATAACTTCACTTCTGTAAAAGATATCAAAAAACTACAACAACGATCATTGCATGTGTTCGCCTGCCTTCGTTC
AGCAGGAAGATCGGTGCGAGGAAACAGGAACAGTGCAGTTCGCTTACGCAAACTTTTCCGAGTGGAAGTCGAAGATAGTACCCTCCGCCTTCGAGGACGA
GTACTTCTTGCACACGTTGTACAATATTTCTTCTAGTTCGTGGGGTCCGCAGCAGAACACACCAACTTCTTCACCGGGATGCTTGGCTCTAGCTTCTGCG
AAAACCTTGTCCCAGTCTGGTCGGCCGAAGTGCGTGAGCTGCTTCGTATCCATTCCAGAAACAAAATCCTTGCCTGTCTGTTCGTGCACGAACTCCTGAA
ACATCTTAAGCTGCGAGGTGTTTTCTTCTCCACCCAACACCACAGTACTCAAATACTGATGCGTCTCAATCACGTTGTCGCGGTCCATTTCGGTGATCTG
CTTCATGGTGCCCTCGAACCAACTAAGAGACTCCTGGCCACGGGTTACCCAGTGAAAGTAGAGCTTTTGGATCTGGAACGAGCTCGGGTGACGAATGTGG
TTGCAATTTAGGCAACGGTTGTCCTCCCACAGATGAACCACATCTTTCAAAATCGACGCGAACGGGGTGACACCGATGCCACCACCGATGCAGATCACCG
TTTTATAACGGTGATAATCCTGGGTCGGTGCGCCAATGGGACCATCAAGGTATACTGCATGTTGCATGCGTGGCAGTCCGCAATAATACGAGCAATGGCG
TCCGTCCAGTCACCACATACACGAATGTGAATGCTGATGTAGTTGTCGCCAGGAGCGGATGAAATCGTGAACGGATGCCACTCGTGAGACGAAACCTGAG
GACAGTTGAGGTACAAGTACATGCCAGGTCTGTAGACGAATCGACGCGGTTTCTCGATGAACAAAGCCACTGTCCCGTCAAGCTCCATAGCCTCCATGAT
ACGCACCGGTGCAGCAAACATCTTGGCGTAGCGGAAACGACGTTCAATCAGATAGATGAGGAATGGAGGTGTGATCCAGATGTAGGCTGAACAACGAGCA
AGCCACGAGGTAGCTCCGTGGAAGGCCAGCACAACCAGGAAAGGTCCGAAGAGCATGTGCGAGTACCAGAAGAGATTGAATCTGCCCTGACGGAACTTGG
GGATCGCAGCTAGCGGGAATGAAATGCAAGTGATGACGAGAAGAATCACACCCGTCCAGACCGGAAGAGCCTGCAGCATCGTAGTGAACGGAGGTCGTTC
ACCGTTCACAAACGTCGACACGTGACGAGTGACAAAGATGGAGCGCTTGACCTCGTCTGGGGTGGCGATCAGGTACAAGTAGATCTCGTTGAAAACGTGA
GCGATCGTATGGATGAGACCAGCAATGAGCAGCACGCTACCCGAGATCTTGTGAAACGCGATATGGTCGTCAAACGGGATAATACGCCACAAGAACTTGC
TGCGCTTCATGACCTGCGTGATGGAACGACACATCGGAAGCAATACAAACACACAGTTAAGCATGGCTACCTGCGCGTTGGCACGAGCGATACGGAGACC
CCAACCGATGGCCGGGTCGACCTCGTACATGAACCACTTGACCCAGAAGGCAATGTTGTTCAGTATGAAGTAGATGAAGAGCCACCAGATTCGGAGCTTG
TTGTCATTGTACCACTGACCAAATTTACTCTTGGGTCGAATGGGGGCTGCGTACACCGGTTTTGCTTCTTCGAGGTGTCACGTACGGCTCGAATACCCCG
CAAAATTGTTTAAACGTCATCGCATCGTTCTGAACACGGGCCTTGCGGAACATGAGCTTGGCCACCGTCCTGAACTCCATACCGACAACGTCGATCTTAG
CACTGGAGAAGTTCGACTCGAGTAGCTGGACGATTTGCTCTTCGACCACGTATCCGGTGTTGTCAGGGTCCAGTGTGTCAAAGATGAAGCGTAGTTTCTC
TTGAGCGTTCACCCCGAGTTTCATCACAGCGTCAATTAGGATAGCGTTGCCGTCGATCGTACCGGTGCTAGTAGCGTAGCCGTCGAACTCATCGCCGTCC
ACTTCAAACGCCTGCGAAAAGGTCTCGCGTTCAATGTAGCAGTAAAGTTGCCCATCGCATCACGAAGCGCTTCGAGCTTCTCCATGGGCGTGAACGCCTT
CTCATCCATGCTCATGGCTACATTGTACTGTTGCTCAAAGTTGCAGTCCCCAGGGATTGGTACGGTCACCACGTCACTTCCGGGAGGTGGGCCGTACATG
TCGTTCTTGCCTGCGGGCGGGGCAACACGGCAGTTCTTATGAGCTGCACTGGAATTCGATGACACGCTTGACGCGGAAAGCGTCAAGCTCTGACGAACCA
TGTTCGAGCACATCATGGCGTCCACATTGGCACGGCGACGACGGGATCGGCGGTTGTGGCTCCTGCAGTTGCCCATAGCGTGGGTCGTGGCAGTCACGAA
TTTGCTGCTGTCCATGAAATTGGTGGCCGCTGGCTTCCGAAGTGGCGGGTTCTGGTTCATGTTGACCATCGTAGACATCATCGGGGTACTTTTGTCGCCA
AAGTGTGGGGCATTGGGTGACGGTATCGAGACATCAATGAGTGCCTGGGTCTTGGCTGGGGTTATTTTCAGGCCGTCCTTTGACTTGCTGCGCCCCGGGT
TTTTTCGAGAACGATCCATCGTAAAAGTTTTGTGAAACCAAACCTTACTGCTTCGAAAACACCAACACCTTTGGAGACACACTGCAACAAGTAAAATGGA
GAATGAGAGCTGTGGGACGTCGAACCGAAAGTTGGAAGTTTGACACCCAGCGGTGTTTGCCGATCAAAGTCACCTTGAACGCATGTTCTGTATGTAATTC
AGACATCTAGAAACGCGCGGTACGGCTATCCTCCAAACCTATGCTATTATAAACGATGACGGCGGGTCTACACGTCGGGAATGCATCGATCCTCTACTAA
CGTTTTACACAGACACGTTCAGCGCCTCGTACGCAGAAATAAGTTAGAATGTGCAAATGCAGCTCGACAATACTTTTAAGTAATTTTTAAAAATATTAAA
TATCTTATTAAATACAGCAGCAACATGTTCTGCTCCATTTGCACAGCCCCTTTATCGGAGAGTGCCAGCGTCAAAGAGCTGAGTCAAAACCAGCAGAGGT
GTAGTTTTCATCGCTTTCTCGGGTGTATCAGTTCGGGATCCTGAAATCGTCAAGTGCCGTTACGACAGCAAGTTATAGTCCAGCCATATTTTCTTTAAGG
CCAAACGTGATTAACTGTCGCGCACTTCATGTTAAACCACAGAAACACGCACAACCAGGATCAGCAATGGGACTTCATTTCTTTTCCTCAAGCACAGCCG
AAGATGCCCATGTAAAAATGCTCTATTGCGTTTCTAGTGTCATGTCGTTTAACGCTTTGTGTTTTGACGTGGTGGCACTCGCAGTAAAGGTGTTTTGGTT
TTAAGCCCCCCCCCCCCAACGGCAAACTGGCAACCATTGCGGGAACTCGTCGCCGATTGCAAGGCGGAACGCGTACATGTAGATGTGTGCTTCGTGGTCT
TTGCAGCTACTTTCGTAAAGCTTACGCCAACTTTAAAGAATGCCACTGAGTAGTGAAGGAAACGAAAATTGAGGACCAAGTACATGTATACAGAAATTGT
TTCTGTTCGGACGAGGTGCGATGTACTTGTAGTTGCTACCGATAGGCTTCTGCTGAACTGGCAATCGACGCAGCGCTCACCGCGCTTTCCTATTTTAATA
GTGATCACGATAGGCATTAGACTTCAAGAATCCAACAATATTTCGTTAATTTGCACCGCGTATTATCTTACTTTAAAAGGGCTGTGACTTGTTGGTCGAG
TTGCTATTGTTTTCCCGCGATGCGGGGACCGAGAGCGAGGTGGTAACCAGAATCCATCCCCCCGTTCGCGCGGAGGGTTATCAAGTACTTGAACGCGACG
ATCGATATCGCGCCAACCTCCAGGTGACGCACAACTATCCGTATACGAAGAAACACCTGGATCAAAATGAGCTGCGATCTGTTCACTACTGCATACGAAG
CTTTGCTCTTCATCGCCCTCTTCGTCGTCGTCTTCGTCTTCTTGAAGCGTCAATTCGTGAATTGTAAGAGCTTGTTCGTCGATTCTTTTTTTCAGCTTCT
GTCGCTCCAATTGCAAGTCTTTGATTTCACCCATAAGCTCACTTTCCTTCTTCTTGTCGTTGTCGCTCTGCCAACACTCTCTATTATCTCGTATCCTGCC
CTTGAGTCGAGCTACTTCATCTCGTAAGACTTTGCATTGCTGGCGTAAGCTGGCAATAATACTTTCGTCCTCAGTTGAGGTAAATTTGTCCGTTGAGCCA
GCAATTGAGCTTGGTGAGGTGATATTAGCACGGTCAGGGGAGAGCTTGGGATTTGACGGGGAGACGTAAGTGCCATCAGCCTTCGCTTGCAACAAGTCAT
CAATTGTGTGAGCCTGCTCCTACGGATAAGCAGACAACGTTGTTGGCTTTCAACCTCTTCTTTTGTAGCCATAAATGCGTACCTCAATCAACAGGTTGGC
ACTTAATTGCGCTTGTACAATCTCGTTCCAGTGCTTTGACTTTTCTTGCTTTAGTATCTCATACTGCGCGACAAACTCTTCATATCGATGGGTGAGCTGC
TCGTGATCTTGTGCAATAGACTTTTTATCGGCTTCAAGGTTACGAATTTGTTCCTCCCACTGTTCCCGCTAAAACATAAAGAAAACAGTTGAGACGTTGT
CGTGAAGGTTGCTCATTAAACAGATAGAGCGAACCTCTTGCAACCGAGCAGCTTCAAGTTCCTGAAGTTTCTTGCTTTGGTCTGCTGTCTGTCAGCAACA
AAAACTGACCGTTAGCTCTCTGTAAATCGTAATATTGAAGCGTACACCGCTACTTACGACTGCGGTCAAGTTTGTCAAGTTCTCAACCAAGTCCTGCATC
GTTTTCTTCGTCCCTTCCATCTGCTGAGTCTCTTCTTCTCGCTTTGCACTCATGTCTTGCACCTTATCTTGAGCTTCCTTCAGCATGCTCAGTAACTTTT
GCTCCTTTCCTTGAAGACCTTGATGCTGAGCAGTAACTGTCTTACATTTACCGCGTAACAGCTCGCACTCCTCGATAGCAGTCTGCAATTGTTTGTTTGT
CTCTAAATATTTGCTGTTCACTTCCTGAAAGCGATCCCAGCGCTCAAGCTCCAGATTCTTGGTAACTTCGAGTCGTGTTTGTTCCCGAACTGCATCCAAC
TTGATGTTCTCATCCAGTTGTTTTTGCTCGAAAGTCTTTAAACATTGCGGGCACGTGACGCTCATCTTCTTCTTTTTCTTCTCAATTTCCCAGCACTCTT
CTTCTTTCTCCTTCATTATTTGTTCGTGCCGCGCTTTCAATTGCCTCATGGTCTGATAAAGCTGCTCATTTTGTCGTTCAATACTCGTGCGTGACCGGAA
TAAACCATTGTAATCTTCCTGCAACATCATCAGCTGCTCTTTCGAGTGCTGATGATTTCGCAACACCTCTCGCCACTTGTCCTTCATATGCCGCACCAGT
AATGTGTGTTCCGCCTTTAGCTCACTCTTCGCGTGCAAAGCCTCCTGCAACGCTGTCCCCAAATCAGCTACTTTCCGCTTGTACAAAGTAACCTCAGCAC
TCATTTTCTCCTTTAACTGAAAACTCGAGCGCTCTCGGTAGCGAGCATCTTGCAGTTCCTTGTCGACCAGCTGTAACCTCGTTTTGCATTTTTGCAGCTC
ATTCGCCACTGGACGGTGAGCATTTTCCCATTCCTTTCGCTCGGTCTCTAACTTTCCTCTCAGGTGCTCAACTCTAGCACGTAAGGCTTGACGTTCTTCT
TGAGTTGCTCGCACGTTAGATGTTGCCTCTTTCTTGACCAATTCTACTGTTTCCTCGTGTTTCTTCTCTAATGTCCGTAGTGTCTCGTTAAGGCGGAAAA
CTTTGGCTTGATCCTCTTGTCGTTGGTCTAGTGCTGTCTCTAGTAACGAGCTTGTATGTGCGAAGTGCTCTTGACATTTATCGCGTTCTGCTTCTACAGC
TTCCACTGCTGTTTGTAGAGTAGCGATCTCGCGCTTGAGCTGAATCGTGTGCGTACTCGCTGATGCCGCCGCACGAGCAGCACTCTGGTCCTTCTTGACC
AACTGCTGGCGCAACGTCTCCAGGTCGCGCAGGAAGGATTGCCGCTCCTAGCGAGACAAGTTAGAAACAGATGGCTACATTCGTCTACGACAACTTCAAC
TTGTGACTCAGTTTACCTTGTCGAAACATCGCTGAGCGTCTTTCAAAGACAGCGTGGAGGCCGCGACCATGGCTTCTCTGGCCATGTTCAGCGGATGGGG
AACCCTGCAGTCATGCACCGTGCTACGGTTCACACAAACTCGTAATCCTGCGCTGCATTTAGATAACAGAGTACCATGTTTCCTCTATGAATAGATATCC
TTGTTCAACAGTATCAATGTATTTACATCCCACGACTAACGCAAGGAATCAAAGGCAATTTAGTATCGATATCTTCGCACAGTTTGTTGTGGGAGCTTGG
TCGGTTTTATAACGATGAGTTGTGTGGTGTACACCAAACTTGAAGTACGTGGTCGCACCCAAGCTCCCCGATGGCGCTGCGTCTACGCCAACTGCAGGTA
GTGCATCGCCACGGCGACCGCACCCCACTGATCAACATCGTCAAAGGGAGCGTCAATGCGCTGGCCGAAGAGGAGGAAGTACTGCTGTGGGGTAGCCAGC
TGCCAGCGCCGACGCAGCTTGCGCAACTCCGTTCCAAGTTCAGCGTTCACCTGGGTGGAGAGGCTCAGACGTCATTCCAACAGAGGCCGTTCGGATATTT
GACGACTCGGGGCATCGATCAAATGACCAAGCGTGGTGAACGACTGGTGAGGTGACAGTTGTCACTAAATTGTTAGGTCGGACTGGAACAGCTCAAAAAC
GTGTGTGATGATATTGGACTCCAACAGCGAGGATTCTGTAAGAAAGAGGGCCTGCAATTGGATGAAGTGTCACCTGAGCAAGTGCAGATCTTCAGCAATG
CGTACACACGCACTCAACTGAGTGTACAGGCACTACTGAGTGGAATGTTGAGAGATCAACCCCAGCTAAGCCCTCCAGTCAGTGTCCTGCCACCGGAAAA
GGACATCATCAACAGTACGTTAATACTTGGTTTAAATTGTGTTCTTGACGCTGAATTGGTGATGTGTTATAGCGTACTCGATTTTCCCGGAGATCATGCA
GATGAAAGCAGATTTGGAAAAAGACGACGCTGAGTTTGCTGCTCGTGAGCACGAGATGGCTCCGATCAAGCAGGAGTTGACGAGACTGTTCCCAGCGGTT
GACTCGGGCCAGGTCCCTTTCACCTGGTTAACCGCAGCCGACTACTTTGTTTGCCGTCGCGCTCACCAGGTTCCTTACATTCCTGGCACCGAATTGCATG
GCGATGCCACCGAAAGACATCTTGGTTTCCGTTTCCACCAGGTAACAATTCCAGCGAAATGTGGCAGCAATCAAAGAAACTGTGAGATCTAAAGATATGT
TGCTGTGGTATCCGGTAGTTCTACTCGCATCGAACGATTCTGAAGCTTGTGGCCGGACGCTTGATGCACAACGTGCTTCGTGAGGTGGGTCAATCATACT
AAAGGAGTTTGTGTGTGTTGCTAACATCCTTCGTGTGGTACAGATGCAAAAGGCTTTGTGGGACCACAGCGAAAGTAAGAAAATCGTGATTTACAGCGGA
CACGACGTGTCTTTGTTGTCGGTCCTTCGAACAATGGACGCCGAAATTGCAGATGACTTCAGCTTTTGGCCTGAGTATTCTTCTGCCCTCGCACTGGAGT
TGCTGGAAGATGAGGATGGAAGATTTTTTGTTCGTGCTCGGCTGAATGGCGAACTCCTCACAATGGGTGAAGAAGAAGCCCCAGACGGTCTTTACTCTGC
TGACCGCTTCCGTGACATGGTCTCCGACCACATTGGAGGTCATAAAGATTAGCTACTTTCCACTAGCTGCAATAGTCAAGGGCTCTTACGCCAAATCAAG
GACGGCAGTAGACGTAGACATTTTTGATTCTAGAGGCAGTTAAGCCAGCAACTCCGCCACCTGCAAGGCACGCTTGTAACGTCGCCGCGCAAGTTTAATA
CTGAGCATCTTTTCTTTCTCCTCAGCGGCGGCTTCTTCATCTTCTTTTGCAGGAACGCCAATGTCGATGATATCTTGCGCTGAATCCATGACACGCTGCA
CCGGAGTATTCAAATAGTAATTAGCACATAGCTATCTCTTTCAGTGCCGACAAAACTAAAACGGCTACCAACCTTGCGCGCAGCTCCCCGAATGCCATTT
AGATATTCAAGTACAATGGCGAACATGGACTTTGGCACAACATCTGCCTCATACATCCACTGCAAGATCCATTGCTGTTTGATTGTCTGCGCACATGACG
CACGATAAAAAAAGTAATGAGCTTCACTTGTTGATGGTCTCGCTCTGCATTGCAAGCAGACAGGTATTATTATTCCAACGCACTTTGAACTTCCAAGGTA
ATTCGTCATCAGCTTTGGGCTCGTTGCGCTTTTGCCACTGCTCAAGATAATACTTGGCCTGCTGGATCATCTCCGGTGATCGATCGGACTTGCCGCCACC
CTCCTTCACCTCCTCAGCATTCTTCTTAATCACGCGCGCGCGTTTCTTGGGAACCACCTGGTCTCCATTGTCATCGAACTTAACGTGCGACTTGGCCGAC
TCCTTCTTGGCCTTAGTGGCTTTCAGCTTGCCGCGCTGCTTTTTCGACAGCTTGGTGGCGGCCATGTCGACACAATTCACACTACTAATCGGACCTGTGC
CAACCAAATTCCTGCGACGTGTGGAGCTGGCGTTGTGTACATCAACATTCAAAACCCACTGATTGGCGGAGCCTTACGAAGACCATCTCTGATTGGTGGA
TATTTTTCCAAATCGGCAACGGGCTCTCGCCAAAAATCGTCAATAAGCTCACGGATGCAGACGCATCAGTTCTCTTGTTGCGAGCGAACGGGCAGCTACA
GTACTGTGTAGACTCGTCTCTTGATATCCTCAACAAATTCTGCAGCGGGCAGTGCATCTTCACTGAATACCGGTAAAGCGTCATATTCAAAATCTGGCGG
AATGTGCATCAATCGCAAGCATCCACGAAGTGAGCAGCCACAGAGTCCCACGAATCAGCAGTTCCGTGATGCCGGTGGCAAGCAATTAAAGCGTGTTAAA
TCTGAGTCGCCGACAGCGGTGGATCACGTTAGAATAGAAGACATTCAGGACAGGGATGAGGAGTTTGCGACGGCTGCACACCGAGATGAGATGGTGGCGG
CCATTCTGACGATCACGTCGGCGCTAGGATTGTCGAAAGAGACATTGCATTTATGCGTTGGGCTATTGGACCGGTTTTTAGCACTTCAGAGCATCGAAGT
CTCCAGACTTGAAGCACTCAGCATTTCGTAAGGATGCAAGACCGAGACTGCTTTTTTTTCGTAAAACAAAAATGCTAACATGTTCGGTATGCTCTACAGG
TGCTTGTGGATAGCTGTCAAATTTGTCGAGACACCAACGACTATTTTCGACAAGAACATCAAAGAGGTTTTACAGCGACGAAGACACTCTAGCAACGTAG
GGTGCCAGTCATTTTGTCTACCGTAGCTTCGAAGCTTATCATTATGTCGCTACTTATTTACAGTGGAAATGGAATGAGATTCTCAAGTTCGAGCTTGATA
TCTTACAACTTCTCAACTATCGGATCATGACACGTACAATACTAGGTGCGCTTCAAAAGCGAATCTATACCCTCGCAGACCACGATAGCCTTGAGTACGG
AGTTCATTCGCTGCAGCTCGAAGTGCGCCAGCTAGCGCTTTATTTTGCTGACTTGCTGCTGCTCAAAGCGCGAGCGAACCAGTTCTCGAAGGAGCTACTC
GTAGACGCTATCTGGTTTGTGATCTCTGGCAACGAGATTGCGGATGTGAAGCCTCCTTTGTTGGAACCGGTCGTGCTGCTTTATCTCGCACACCGCGACA
ACATCAACCCAAGTCACCCGGTTTTCAAGTCGTGGTTCGCGCTTCGCTGTCGTTACGGTGCCTTCCTTCCGGCGCCGTGGAAAGTTCCTTACAACGCGTC
CTGCGTCTGCCGAGTCTGCGAACACGCACACGACGATCTCGCGTCCGGGTAAATTAGAATCATCAAAGCTTTACCGGTACTGCCTTGCCTGCCTAAGACA
ATTGCTGTAATGTACCATACCAACTTTGATTCACAGTCCATAATAGTAGTACGTAGTACAACACAAAGAGATACTTCGAAGTACTGTGAGTCCAAAAAAC
AATAATGCGAGCTACCATTTGGTCCCCCACGTGATCCCATCTCCTAGCTGTATCTGCATGTTGCCGTCTCTAACGTGACTGACAGACGGCGTCTATCACC
GATGCAAACAAGCAGAGGTAAGATCTGAAACGAGGGTTAAATCTCCCTACAGGAAGTGAGTCTTGCGAAGGTCCTGGTACTTCTTGTATCCGGCAGCAGC
AATACCGGCAATGATGAACACAATGATGAAGAACGGGGTCTTCCAGCTACTGGACTTGGCAGCAGTTTCTTTCACAGTCTCTTCCAGCTGTGAGTCGACC
TGGTCGCGGATAGCGTTCACTGTACTGTGCACACGCTCGACCACTTTTCCGTTTGCCCAAGCCTCCAGCTCGGCAATACGCTTCTCGTCCTCTACACCTT
GCTGCTTCAGCTTCTGAATCGTGTTTTCCGTCGACTCCTTTAGTGCTGTGAACTGATACTCGAATTCCTCAAGCAACTGAGCGTATTTCCGCTTGACCAG
TTTCATCTTGTCGTCGTTGTTACCCTTACTGAGTGTGGCTTCAAGGTTTTTGTCCACTGCATCGCGCTGCTTTTCATCCTCCTGTGCCGCGAGCGAGTCA
ATGACGTCACTACAGAATCAAAAAGAAAATTAGCATGCGATTCTCATGAAAAGATACACAGAATAGCTAAACTTACTCGTAGAAGTTGAGAGCGACAACG
TCGTGGTTGTCTGCGAGACCACCTGTTGAGGCCGAAATACCGACGTAAGCATCATCCATCCAGTCATCACCGATGTTTAGACGCTGGTTGTAGCACTTAA
CCCAGTTGCCCGACGCGTCAGCATCTATCAAGATAGTTAATTGTCGGTCGGCCTTTGTGTATGTGATCTTAGCACGGGACATGTTGAGCGACGGACTGAA
GGCTGCGTTCTTCTCATGGTAGCGGATGCCTGGAGCCATGCAACCCACTTTCTCCATGTCGTTGAGCTGGTCCAGCGTCTTGCTGCCGTCGTTCTCGAAG
AAAGTCACATCCTTGTGACCACCGCTGTGCTCCTGGTTGACGAACGTGTCGAACAGGACGCCGATACCCTTGAACTCGCCAATGAAGCCGTGGTTGTCGC
CCTGCACGTACTGACTCGTTGTGAGCCACAGCGCCAAGCCATCGCCGAACCAGGACTTTGCTTGACCACTGATTCGGAACGTGAACACGGCGGCAAAATC
CTTGGCCGCCAGCTTCTGCTTTCCCCAAATGTATCCGCGCTTGCTCTGACGATCGGGTGTAAGACGGGCAAAGTGGCGGTTCACGGCTGTGTCGCTGCCG
TAAACGAAGTTGTCTCCGATCTGACGCAGACCCTCGCCGTCGATGTTGTCGAAGGGCTTCTCAAAGGAAACGTGGTCGAGACGTTTAGCGCTAGTAGGAG
ATGAGTGCATCAGCGCAAAAAGCGCCACCACACTCAGCAGCAGCATGCGGAAGACACTCATGCTCAAGAGGTGCTCAGGGAAAGAGGCTGCCGGGATACG
TCGGACTCCGCGATTTGCTACGTGGC