Description :
From Genome Similarity Track
Location :
Scaffold_1:1551158- 1552527
Transcript NameFunction/comments
Sapdi_VS20SDRG_00517hypothetical protein

Sequence
1369 bases(100 bases per row)
CAAGGTTGACGTCGTCTGCGTCGACAAGACTGGTACGCTCACGACCGACGCGCTTTCTCTCCGGGGCGTCGCGGGGCTCACCGCGTCGTCGCTGCTCCCG
ATCGCGGACCCGCGCACCCTCGTCTCTCCCGGGTCCCTGCCCATGGACGTCCAGATCGTCCTCGCGAGCTGCCACGCACTGGTACCATGCATGCGTTGGC
GCGTGCTCATGGCGCGCCTCGTAGATGGTGCTCAACGGCGCTATCGCGGGCGACCCGCTGGAGAAGACGGTGCTATCGCACCTCCGCGACTGGACGCTGC
ACCAGCTCGACCGCGTCACCTCGCGCTATCCGTTCAGCGTCCGATCGCTTCGCATCGTCCATCGCTTTGGCTTCTCGTCCGAGCTGCGGCGCATGAGTGC
ACTCGTATAGCAGCCCTCTTCGATTGAAAAAGTAGAGCAAACGCGTAGGTGCTGGTCGACGACGGCAGCGCTGTCGGCCACGCGCGGGTCGTGTCCAAAG
GCGCCCCCGAGGTCATGGAACCCCTCTTCGCCAACGTAGCTGTTCCCGATTGGCGCTCGTCTCACGGGACAGTAGGTGCCGTCGTACTACAAAGACGTGC
ACGAGCACTACGCTCGCAAAGGCGCGCGGGTGCTGGCACTCGGCTTCAAGCGCGTGCCGATCTCGGACTTGGCAAGGACGCGGCACCTCGCGCGCGACGC
CACCGAGACCCACTTGACGTTTGCCGGGTTTCTCGTCCTCGACTGCCCGCTCAAGCGTACGTCCCGCAAGGTTGACGATGGTTCTCCTGACGCACGTAGC
CGACTCGCGACGGGTCGTGCAAGACCTGCAGCTGGCCAACCACCGCGTCGTTATGGTCACTGGCGACAGCGCGCTCACCGCCTGCGACGTCGCGCGACAG
GTTGTCTGAATTCACGGCACTTGAAAGAATGTCATGATGACGTCAGGTGCATCTGTTGCCGCACGCAGAGACACTCGTGCTGGAGCCGTCGCCGACCGGC
CTTTCGTGGACCAGTGGGGCCGAGAAGCTCCCATTTTCCGACGCGGTACATTGTTTGCTCTAGTACACACTCAAGCTGCACCACTGCTAGACGCTGGCGA
CACTGGCTGAGACGCACAACTTCTGTGTGCTCGGAAGCGCCGTTGCAAGCCTCTCGCCGACGTCGCTGCAAGCGCTGGCACCGCTCACGCAAGTCTTTGC
CCGCACTTCGCCCGACGAGAAGGCTGGCGTCCTCGCCGCCTTGAATGCGTGCGTCCTCAGCACGCCACGGGTCATGTCATTGTTGGTGCCGTAGGAGCCA
AAGCGTCACGGCCATGTGCGGCGACGGCACGAATGACGTTGGCGCGCTCAAGATGGCGCACGTCGGCAT