Description :
From Genome Similarity Track
Location :
Scaffold_208:15511- 17474
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_208-snap-gene-0.24C-1-tetrahydrofolate synthase, cytoplasmic
Pytul_var.sporangiiferummaker-pug3_contig_208-snap-gene-0.15Conserved gene of unknown function

Sequence
1963 bases(100 bases per row)
CTGCTCGCTGCTGCTGCATGCGTTCTCCAGTGCCATCTTCTCCTGCCTCAAGCGCATCTGGTAATGGGATATGCACTTTCCACGACTCGATGCTGACGGC
TGTGCACGCGCGCTGCTTCATGCGCACGTACGTGGCCGAGTCCTTGCGCGCGCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGTGGCCTTGCCGTCCAGCACGACGGCATGCGGCTGCTCCTGC
TGCTGATGGTGGTGGTTCTCTGTCATCTCGACGGCCGAAAGAAAGAAATGAGCGTCCCCCTTCTTCTTCTTGGATACGTTGCGAATCAGCAATGAGTGAC
ATGCATTCAACGTGAATGCAAATTCGACTTGCAGGTCCCTTTGACAATTGATTGACCGGCTTTGGCGGGTAGAACGTGGCACAAATGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTGCTTTCGTTGGATGAAATTACTGCATGAAAAAAGTTGTGCAATTGTGCAACCCGAGTCCTAGTGTAAGGACCAACATTCGA
TGGAAGAGGGGCTTGTATTGGAAGCTGGTCACGAATGTGCCAACTGCAAGTTGGATGGAGCCTTCCGCACCTCTGGTTGAAACCCGAAAGTCCATAGCAA
GGGGTGAACGCTTTTGATGGAGATGTTCTGCCACTACGAACAGAAAGATCGCATGGAGATTGTTTGCAGCGGTTAAGGAGTCCGCCATCTTCATCCTTAA
GCTGATAGTCTATTCCATCTTTGTCTCGGCATTGTTTGCCATGGGATTTCAGTCTTGTGTCAGTCTGTATTTCCTTCTCTCAAAGTAGAGGAGGCGCACA
GCCGTCTCAAATCTTCGTGCGAGATCAGCGATTTATACGACAAGACCGACAGCCAGGACGTCTCAGTCACATACTATCCTAACAAAGTACTTTTATGACA
AGGTACTTTATTTCATGATCGCATCAGATTGGCTGACGCCAGCTCTCTTCCTTGCTACGATTGGCCGATATTCCTCCAGATCTCTGCAGAGGTTTCAGCA
ATTCACAGGGGACACTTGTTGCGCGCATATTCGCCCCCTCCTCGCGACTATGGTGCTACTCGAGCTCTTCCGCTTCTGCTTCTTGGCGCTGACGGACGTC
GCGATGCTGCCGGCGCTGGGTGTGATGAAGCGCAACCACCGACACTTCGAGCTCTTCGTCGGCGTCTTCCACCTTTGCATCTNNNNNNNNNNNNNNNNNN
NNNNNNGCTTCAACGCGGCCGAGGCGTTCCAGGCGCAGCTCTTTTTGCGCGAGCTCCAGTGGCACTTCATCTCGGACGTGCTCTCCATCACGTACTTTTT
GCTGCTCTGCGTGCACCTCATGGGCTTCAAGGACGAGGATCGCAACATTCTGCTGCGCTACGTGGCGTTCGCGTTCGCGTGGCTCATGAAGGCCAAGGAC
GGGTGGGACTCGACCGTATACGAGGTGCTGCTCATCGCGAGCTACGTCGCAGGCGTCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATCGCGCCCATCCAGAAGGACAAAGCCAAGCTCGCACTCATCTTCCTCGTGTGCGCGGCACTGGCCGGCGGCATCCCCATCTACTTCGGCGGCA
ACGCAAAGGACGACGCGAGCGCATTAACGGGCGTGGGATTCGTCAAGGGATGCATGCACATCCTCGGCGGCGCGGCGTTCTACTATGCATGGCTAGCAGT
CCCGTGTCTAGACTCTAAAAAGACAGACCTCATGCCAACATACAGCAGCTATCTGTAAAAGGAGGACTCTAAAATCTAAAGGCTTCGAGAAAAAAGGCAC
TGGCATCACGACCGAGACTGGCGAAAGCAGTCGTAGAGCTTTCGGACAGGCCGGATATCGTCT