Description :
From Genome Similarity Track
Location :
Scaffold_6:1550943- 1558855
Transcript NameFunction/comments
Physo_259239Hypothetical protein
Physo_381518PREDICTED: similar to ENSANGP00000028549 putative
Physo_336743Hypothetical protein

Sequence
7912 bases(100 bases per row)
GAAGACTCGGAGAGGATTCCGAAGAGTACCTAGCCATCCAGGAGACGTGGCTCCAGTACTCGGCTGAGCGCAACGCTCGGTCCGATCGCCTCCGCATTCA
GATCAAGCGCTGGTGGGCCCAACTGCTGCCCGATGCGGATGGGAAATTCGGCTACACCCCCGAGGTATTATTCGAGCCCTCGGTCCTGCACTATTCCCTC
GAAACGCTCTCGTGGCTTCCGTCTTCGGCAGATTGGGTTGAGGCAGTCGTTGAAGCTGATGGCCACGAGCCTTGGCGTAACTGCTGGATTGCTGTGCCAA
GCATTCACCCCTACAACACCAGGTTCGCACCATGCAACCCTGGGGCGATGCTCTTTATTCCTCGCGGGTTCACTCTCCAGGAAGTGGCGTCTGCCGTTAT
CGTCAGTCCGGTGCTCGAGGTCTCGGCTCCGTGGGTCCGGGAGTACACCCACTACCACGGCGTTCCTGCTCCTGCTGAGGAGCTTCTCGATGAAAGTTCG
GTTCAAGCAGCTACGGACGGGCAAGAGGTAGCGGGGAATGACCCACGGCCGGATGACTCTCCAAACGGGGCGCCGACTCTTCGTTCGCCCGAGCGCTCGG
ACGATGCTGCTTCTCCTGAGCCGAGCCTCGTTCCGATACCTCCGGCTGGATCTGACGAGCCCGTCCTCAGTTCTGGAGACGAGGACAACCAGATCGAGGG
CTCGGTTGAGGAGTCGACATCTCCGCCGGGACTCCAGCGCCCGGCCGCTGGCTCTGGCCACCTCCAAGTGCTCGCTCACGCCGCTTCCGCGTCGAAGCCA
TAGGCTCGCTTTCTCCTCTTCGTTTCTTCTGCCCGGCCTGAACGTAGTCTTCTCGATGCATTGTAGTGTTTCTCAGTCTGTGGGCGTCGTCAGATTTCTA
ATTTCAAATTCAAACAGCATCTCCATGCCTCCACTTGAGTAGTTCGTAGGATCCATCCGAGAGTTCGTGCAATATGCATACATGTAGTAAATGTTGCTGC
AGTAGTTCTTTTCGTCTGCTGAGGCGGGCTGCATCGCCCCGCCGGCAGTTCATCATGTTGCGCCAGTCGCATCTAGTGCTCGTCTGCGACTTGGACCGTC
TGCAAACGACGATCGCTGCGCTTAGCGCGCAAGTAATCGTACAGCATCCCTCCGCACGACAGGTTGGACGCGGGCTCCCACGTGGGTTCATCATAACCAA
CCCATTTCACTTGGAACTCTCTGACCGCGCGTTCAGTGCCCGTCGAGAGCGGCGTTCGATCATCCAGAATAGCCTCCACCTCGTACTCACCAGTGAGGTG
GTCCGATTCAAAGCTGTCTTCGGGTAGAAGCTCTTCATCGAAGTCTAGTCTCGTCTCATCCGTGACGTCAGTTACCAACCGAGTCTTCGGTCGGTCTCCA
AACTCGTTCAATTTCTTTAGTCGAGATATGGACGACTGGGTAGAATCTATACCCACTCCGGTCTGGTAGAGCCAGCTCATACGCGTACTCGTCCACCTTC
TTCTTGATTCTTAAGGGGCCATGCCAGCGATGCGCCAACTTCTTCGTCAGCCCCGGTTTCACACGCTCCATGTAGATCCAGGCACGATCACCCGGCTCAA
TGAGCGACTTCGAGGTTTCGGTCGACGAGTCATCGGTCGGGTCCATCGTTTCAGTGTTTTCACCTGAAGGTTCGGTTCGGTCAGACGTCGGTAGAGATTC
TCGTTCGCGTCGACTCAGGGTCTCGTTGTGCTTCTCGGCTCGTTTGGCTTTCTCTGTCGCCCGGTACTCTTTGGCCATCTCCAAAGCGATCTCCTGTTGC
CGATTGACTTCTCGTCTCCAAGCCAAGGCGTCGGTTTGGCGACCGCGGCCTCGTTTCAGTGACGAAGACATAGCTCGAAGTGTCGTCCGCGCATCCCAGC
CGTGTACAAGGTAGAACGGCGTGTCCTTGCGCGTGGCGTCCTCCGAGTTGTTGATAGCAAAGATCAGCTTCTCCACGATCTCATCCCAGTCCTGTTGCAG
CGGGTCTTCCGCGTACACTCGAACGGACTGTATGACATTCTTAACCGAGCGTTCCTGCTGGCCGTTGGCTTGTGACCGATAGATCAGGGTGGCCCGAGAC
CTCGATTGCATCATTTCCGTAAATGCTTGGAAGACTTCGCCCATGAAGCGAGGGTCTCTGTCATGTCGGAGGAGGGTAGTGTCGTATAGGGAAAACACGA
TTTAACGAGTCCTCGTCCCTCTAGCCAAGGCTTTTGGGACGAGCCCTACCAACAACACGCTTCCCTCCTAAAAGTTCGGCGCTTATTGTTGGGATTAAAT
CTGAAGGCCAGATCCGATCCCTTACACCGGGCTGGATTGTGCCTTGTGCGAGTCGTCGGTCAGGTAGGTAGAGCCCGTAAATCAAATATAAGAGCGCCCT
TAGCCACGAGCTACGGCTAGGATGCAATCTACACACGCGCTTTCACGCTTAACCCACTGTGGTCCCTCAGAAGGAAGGGTACCAGGCCAATCGAGGCCTC
GGACAGGGGCGCCGGGGCGAAGCCTCGGCTGGAAGTCAAATATACTGGGGGGCCACGCCACACACCCAGACAAACGTACAACCGTACCGGGAGGTCTCTG
ATACCTCAAACACTCGGCCACCACTCACTCTTGGCCCTTCCAGGGATGAACACTCGGTCAATGTACCTTATGCTCACCGGCAGACATACCCCGCGTCGGC
CGAGCGTATCCAGACTCTACAGCTAAGCTAAGACTTACCGGTAGACGGACTTGACCCTTGTGTGGCTTCGGGGGGAAATTCTAAGGTGCCTGGCCAGTTT
AGCGCAAATTTGCGAAGTGTCGCCGCAGTACAGCGATATCTCGCTGTAGACTGGGGTGATTTGAGCACGAAGACCACCTACCGAAAGCTCATTATTAGGA
CTATCTCGTCTATTTATACGGCTTCTAGCAGGCGATTTAACGAATTGGTGGCTCGTTAGGCAGAGCACACCGAAAGGCCGCCCGTCCAGTTTACCGCAGC
CAAACATATAGAATTTTGTAGCGGTGCCCATCACCCTTTGCCCATTTCAGTACTGATTTCGGAATTTCTACCAATGGTGTGGCCAATACCATCTCCACTG
GATGAAATTGGACAAAAATCCCATTTCTTTTAAGAACGCATAGCAGGCTACAGTAGTGGCTGCTATTCGCAGCCACTGGTTGCCTTGGGTAGCCTCAGTT
TGCAGATGCCCGGAAGACGCTTAAGCTACACAGACACACAAATTAACACCGCCGTGGCCCAAGTTCTCGAGGGTGCCTCTATCTCGCAAGTGAGCAAGAC
GAGTGGCGTGCGCTATCGGACACTAGCAAGTTCAGTAGCCGCAGCAAAACGTGGCGAGTTCCGCGTCCGCGGCCCAGCGCCTCTGCTACCAGCCGAAGCT
GAGATCAATCTCTATGAGTGGGTTCTTGGCCGCCAGCAGGTCCTTCGCCCTGTGACCAGTTCACAAGGCAAGCACAAATCCAACCTACTGTTCCAGAGAG
GTCTCGGTGACGGCTGGTACAAGCGATTCATGCAGCGGTTCCCTCTGCTTTCGACGCGCACAGCTCAGGCCATTTCAAAGGCACGGAACAGCGTCACGTC
AGATGACGTAACGTTGTTCCACACGACGTTAGCAGACGCCTATGAGAAATACGGATTCGAAGCGTGCATAGTCTTCAACATGGACGAGACAAGCTTCGCG
TCGAAGAAGAACACCAAGACCGTGGTTGCAGCTCGCGGGTCCCGCAACGTCTGGACGGCCGAGGTATCAACCAGCTTTCATCTTACAATCGTAGCCTGTG
GTGGAGCGGATGGCACCGCAATTCCACCAGCTTTTATTCTACCAGGCCAAACTGTCATCCTCAACGTCCTGGGCTTTTGCACCGTGCCCAGAGCAGCCGT
CTCGACGACAGAATCCGGCTTCATGAACGCGGATGTGGTGTAGGGAACATCAAGATTTGTGTCACACTCCAAGGCCGCAGTGGAACAACGTACCAGGAGC
CAAGTTCTACTCGGCGGGATGACCGTCCGCCGAGCTCAGTGGGCAAGAATGCGCTGATGGACCGCTGAACTCGGCTGATGGTGTCAGAAACTCAAGCCAC
ACCGGCCCCGACCTGGTGACACGTGGCAGACCCAGTGATGAAGACCCAGCCGAGTTCAGGAAGGCACTGGACAGGCTCATCCGAGATCATGGGGGGGGGG
TCAAGCCGCCGAGCTCAGGCTGAACGGTACCATGTACCGTCCGATACGGTAACCAGGCTCAATTGAGTCCGGGAGTTGCGCAGTCGAGTTCACGGGTCGC
TCTGCCGAGTTCACGAGTCGCTCCGCCGAGTTCACGAGTCGCTCCGCCGAGTTCACTGGGTTATCCGGCACCTTATCCGGCTCAACCGAGTTCGCCAGGT
TATCCGGACACGCCGTATCCGGCTCAGCCGAGTTCAAGGGGTTACCCGGACAGGTTATCCGGCTTAGCCGAGCTCGAGCGTCGCCGAGCTCGGTGAAGAG
TCGGCCGAGATCCAAAACCGCCCACTTTCATTTGGTATTTGTATAGGAGCTTAGGAATAGTGGAGGCGCCCCTTCAGGGCGCCCGACAGAGATAACAAAC
AACAGAGCAGAATTTTCTAGGTCCACAACACGTGCACGCGCTTCCAGTAAGCCCCTGCACGGGCCGGATTATGTCTGCTGTCAGCACCCGAGAGGCATAG
CTTGTAGGGTGTTGACTGGTAGCGCCAAGAGATTAAGGTCGGCCCGGGTTGGGCGCGTGTCTCGCCAAGCGCGAAGGAAAAGTCTCGCCACCGCTGCGAG
CCGGTGTTCCCGTACGTCCCAGGCACTGATTGCTGAGTCGAGAAGCCTTTGCTCTCGGCGACCCGTAAAAGCCCGCGAGGGCCGTCGTCCGTCCTTTGGC
GGAGGGCACGGGATTTCTAATTCCGGAGTCAGGTAACTCAGCTGGCTTCCGTGGTTGACTGGCTTGGGGCACTTGGTCTCGGCGAGGACGAGACATCACT
GTCCCGGAAGGGCCGAACCGCTGGGGGACATCTCAGCGCAGGCCAACAAGGGCCGACTAGCTCGGCTGTTGTTGTGTTTGTGGCTTGGGTGCCACATCTG
ATGATTTTGTGAGTGCTACTACACCACAAATGGTGACGCGACCCGGGAGCAGGGTGGTTTGTTTTCGTTGGTACCAAGTCAACCAAGTTTCGAGTACTGA
GCAAGATGGTCAAGGGGAGATCTTTGCCGAGCTGGGCCAGCCCAGCGACGGCTGGGGGTTCGTTTCACACGAAGCCGAACTCAGCTGGCGGAAGGATCGC
CGACATGATGATGGAAGCGGTCCCAACCGTTCGGTTTGGCGACGACCGCACCCAAGACCGAGGAAGAGATGGAAATATCGGAGATTATGATGAAGAATTG
AAGAAAGCTGAGTTGCTCAGCGGGGTAGCTGAGTTCTCGCTGCATGTTGGGCGCGTGGAGAAACCTCGACGAGCCCAACAAAACCTCGCAGCCGAGCTCG
GTGACGATGCGGACGACGACAGTCAAGCCGTCGCTCCAGGGGACCGTCCGCCCCTGATACAACGAGCGACGAGGGCATCCAGCGCGAAATGCCCGAGTTG
GGATTCGATGCCGAACGTCTCGTGGGAAACCTTTCCACTCGACTAGGGGCAATCGAAGAAATGTGAAACCCGTCTGCAAATGGTGCAAGTTGCAGATGCG
GTCTAAGGCTATTGCACCAAAGTGATGATCCGCCGACTCAGTGAAGACAGCAGGCTGGGTCGAGTCGAAGAATGATACTGCGTCAACTGTATGGATTATA
TGAATTACATGATATCGAAATGGAGTGAGCGAAGATGGAGCTGGAAAGCAAGAAGCCCATTCGCCGGGTTAGCGTTGGAGTCGGCGCGAAGTCTCAGCCG
AGTTGCCGAGCTGAGCGGTTAAGCCCAGCTGGTCTGACAACGACCCAGTGAAGAAGCTGAGGGAGGTGATGGTGCGTCTGCACAGATTGAGCGAGTCAGC
CGTCGATGCCGAAGTTGTGTTGACTCGTCACTGGGTCCGTGAACACCCACTGGGGCACTGTGTGTGATATGCGGCGGTACGATCGACACCCTTGGGTACG
ACCGCCGGGACCTCCGACCAAGTCGATGAACGATCTTCCCGTTGTGCGCTCAAGCTGAATTGGAGCGCAGGTGTGCTGACGCGGAGCTGTGCTGATATGG
AGCCACGCTCAAGCAGGAAAGCCGAAGCGAAGTCGAGTTCGCACGATGTTCCAGTGAGGCCGTAATCACTCCATGTTTACCGAGAGGCGGCTAGCCGAGT
CGGTCGATGCGCGGCGGCGGTGAACAAACCGAAGTTGCAGCAAAGCTGGAGTTGAGCAAAGCTCAGCGGAGGCACGCTGGGCAGGCGCGTCGCCGAGAAT
GTCGACGTGCCAGCGATCTCGAACGGGAGCCGAGTTGATCCGTAGCTGAGCAGAAGCAGACACCTGCTTTGAAGATGAACTCCGACTTCACTCGATCCGA
CGTAGGGCTACCATCGCGTTTATCTGCGGTCAGCCTGAAGCCGAGTCGGTGAAATCGCTGAGTCACGGCGTCGCAAAGGTGTACCCAACATCCAAAGGTG
GACTGAAGAGGAATGGATTCCACGCGGCCGCGGTCGTATTCACATTGAGCCAACATGAGCAGAGCTTGGTCAGGGGTCGAGCATAGCCAAGTCGAAACAT
CCCTTCAAAGCGCTGATACTTCCGCTAAGGGACAGAGCTGGTCAGGCAGCCAGCTGTGTCGTTCGCTCAGTCGAGCTTGCCTCTCACCTTGCTCAACTGG
GCTAAGCTGAAGCGGAATCAATTCCAGGTGAACATGAGTCGCGCTAGACCCGGGTTGATTCGTGGCAGAGCCACAGAACATGGGGATCAAGTGGCGCCTA
GGCGAATTGCAGCAGAGGTTTGTCTTGAATCCGAGCTGAATCGGGATCAGGTACAAGTGCAGCCGAGGTCAGCACCAACTGAGTTGAACCACAGTCAAGC
TGAAGCCGAGATGCGTTCAAGCAGAGCCGAGTTGAAGCGAGACAGTGCACTCTGCGTGGAAGTAGTTTGACACCGAGATGTCGTGAAGCCGAGTTCAACC
AAGCCGGAACGGAGCCGAGTTCGAGCAACGCTTCGAAGAAGCGCTGGTCGTTGGAGTGGAGTCGATTGAAGAGCAACCTTGCCGAAGCAAAGCCACGATC
AAGTTGGGCCGCTTCGCGTCCAGTTCCAGTGGGAACGCATACATCTCGGTCTTGTGCCCGGTTCTCGTCGGATTCCAGCCGAGACGAACTAGGTCGAGCC
GACGTTATGCGCAGCCGAGTCCGAGCAGAGCTGAGCTGAAGCGAGGCTGAGATCACGCTGCGTCCTAATGTGGTCGCGTTCGCACTGGGTTGCTGCGACG
CCGAGAACATTGGAGTACGATCAAGCTGGAATGGGATGCCGAGTTCCAGTAGTGCCACGGGTTGGATGGCGCCAATCTGAAGTGTACTCACTTCAACGGA
AGGAAACACTGGGCTGAGTTGCGGTACGCCAAGTTTCAGTGAGATCGCGTTCGGAAGTTCGCCTAGTTGAGTGCTGGTAAACGCACCATGTTCCGATTGG
AGAGCGCTCATGCCGAGTTCGAGGTGTAGTCGAGCTGAGGCTGAACACGCTTCACAGCTGAACCGAAGATACCGAATTCAAACTGAGTTTGAACGCAGCC
GAGCTCGCGGCGAGCCGAGTTGGAATGTGACCGAATGAAGTGCTGTTCCAGTCGAGCTTGCCCACCACCTTCCCAACCAAGCTGAGCCCAGTCGGGGTAA
GCTGGTCTAACAGAGCGGGAGACATGCCGAAGTCAAGGTCCGTTGACCAATGAACCCAGCTCGACAACTCGACTGGAGCATCAAACGCATCGGGATCGCC
TTGTTCGTTTAT