Description :
From Genome Similarity Track
Location :
Scaffold_6:1550943- 1552172
Transcript NameFunction/comments
Physo_259239Hypothetical protein

Sequence
1229 bases(100 bases per row)
GAAGACTCGGAGAGGATTCCGAAGAGTACCTAGCCATCCAGGAGACGTGGCTCCAGTACTCGGCTGAGCGCAACGCTCGGTCCGATCGCCTCCGCATTCA
GATCAAGCGCTGGTGGGCCCAACTGCTGCCCGATGCGGATGGGAAATTCGGCTACACCCCCGAGGTATTATTCGAGCCCTCGGTCCTGCACTATTCCCTC
GAAACGCTCTCGTGGCTTCCGTCTTCGGCAGATTGGGTTGAGGCAGTCGTTGAAGCTGATGGCCACGAGCCTTGGCGTAACTGCTGGATTGCTGTGCCAA
GCATTCACCCCTACAACACCAGGTTCGCACCATGCAACCCTGGGGCGATGCTCTTTATTCCTCGCGGGTTCACTCTCCAGGAAGTGGCGTCTGCCGTTAT
CGTCAGTCCGGTGCTCGAGGTCTCGGCTCCGTGGGTCCGGGAGTACACCCACTACCACGGCGTTCCTGCTCCTGCTGAGGAGCTTCTCGATGAAAGTTCG
GTTCAAGCAGCTACGGACGGGCAAGAGGTAGCGGGGAATGACCCACGGCCGGATGACTCTCCAAACGGGGCGCCGACTCTTCGTTCGCCCGAGCGCTCGG
ACGATGCTGCTTCTCCTGAGCCGAGCCTCGTTCCGATACCTCCGGCTGGATCTGACGAGCCCGTCCTCAGTTCTGGAGACGAGGACAACCAGATCGAGGG
CTCGGTTGAGGAGTCGACATCTCCGCCGGGACTCCAGCGCCCGGCCGCTGGCTCTGGCCACCTCCAAGTGCTCGCTCACGCCGCTTCCGCGTCGAAGCCA
TAGGCTCGCTTTCTCCTCTTCGTTTCTTCTGCCCGGCCTGAACGTAGTCTTCTCGATGCATTGTAGTGTTTCTCAGTCTGTGGGCGTCGTCAGATTTCTA
ATTTCAAATTCAAACAGCATCTCCATGCCTCCACTTGAGTAGTTCGTAGGATCCATCCGAGAGTTCGTGCAATATGCATACATGTAGTAAATGTTGCTGC
AGTAGTTCTTTTCGTCTGCTGAGGCGGGCTGCATCGCCCCGCCGGCAGTTCATCATGTTGCGCCAGTCGCATCTAGTGCTCGTCTGCGACTTGGACCGTC
TGCAAACGACGATCGCTGCGCTTAGCGCGCAAGTAATCGTACAGCATCCCTCCGCACGACAGGTTGGACGCGGGCTCCCACGTGGGTTCATCATAACCAA
CCCATTTCACTTGGAACTCTCTGACCGCG