Description :
From Genome Similarity Track
Location :
Scaffold_1:155050- 158742
Transcript NameFunction/comments
g38.t1KUF91590.1 Leucine-rich repeat-containing protein 45 [Phytophthora nicotianae
g39.t1RAW41931.1 hypothetical protein PC110_g1882 [Phytophthora cactorum
g40.t1hypothetical protein

Sequence
3692 bases(100 bases per row)
GGCCCCGTGGTTGAAGCCATCCGCACCAAGCGTTTTGTGCCAGGTCAGTTCGGAACTGGCCGGGCAACTGGGGTGCGACGAGTTACGAGCTCAGCGAGCG
CCAGAAAGAGGACTGGAAGAGCCAGCCCCGCCCCGAAAGCCGAGCACGAAAACGCTGCCAGCTAGTGTCGACCGCTGCCAGTTCCGCTTCGGACCCGCAG
AGCTCACACGAACGAGATTCCCATCGCGGAAACGCTTCTCGCCGCTATCTTAGTCGTCCACCGAGACAAAGGCAATTAAAATGGACAGCACCTCGAGTGT
GCAGACTCTCATCGCCCGGTTCGAGCTCATGGCGCAGGCCAATGCTGCAGCTCCGCGCTCCTGGTCCGTGGGCGGATCTAAACGCATGGATCTGCCGTTG
CAGCCAAATTCGCCGGTGAAGGAAATCATCGTGCGCATGAACACACAACGCACCCGCACTCAGTCGGAGCCTGCACAATTGCAGAAGACAGAGGACGTCA
CGGAACCTGCTGAGGGGGAGACCCCAGTTGCTGTGCCAGAGACCCCGACAAAGCCTGCGGTCTACAGGAGCCTCACAGTCAACACGCTGGAGTCCGACAA
TGAGTATGACCCCATGACTTTTAACTCTTACGAAGACGAAAGCGATGCCGACTCAACGACTACGATCAAATCCACTTGCTACTCGGCTGTCCCTCCCAGC
CCGTCGTCCTACTCCACTGCATCCACGGGCTCCCTGGACTCGCTTCTTAGCTCGCTCGACATCTTCCTGCCTGATCTACTGCAGGCGTCAGGCGAGACCA
GTGCTGAAGCCTCCAAGAATGTCAAGCCCACCGTCTACCGCTCGAGAGGCTCGTCGCTCCCTGAGAACCTGCAATCGACAAAGACCTCGAAGCTTGTCCC
GCCTAACTCATATCGACGTGCTTCGCTCACGGGCAAATCGCCGTCCACCACTACCAAGGACAAAGTCTCTTCGGCCCCAAAGTCGCGCCGCTCTTCCCTC
TATGCCGCTAAGAACCCGCCTCCAGTAGCACCAACGCCCGCGAGGTCTCGTCGCTCGTCGCTCTCAGCAACCATTGCGCCGCCCGTCAAGTCGACGCGCC
ATTTCTCGGAATCGGCGCGGGGTGCGCCACCCGTGGTTACGTCTCCGAAAAGCCGCTCGATCTCGACGTCTGTTCCTCGGTACATGGACTACGACAGCTC
GCCGCGCTTTGCGGCCACAAAAGCCAGGAACCTCGAACGCCGTCGTCAGCTTGAGGAGCGCAACCGCAACCTGGCCGCTGACAAGACCAAGCACGTTGGC
AACATGACGCGGAGACCGCGCACGCCTGAGTGGCAGGGTCGTCTGGATCAGGTGCGCTCGCGTCTGTTCGACTACAAGGAGGACAACCAGTTGCACGGGG
CCAATACAAAGGCAACCACGTCTCGAAGATACTTGACGTCTAGGCGCCGTGCCTAGCGTGTACCGGTAAACCTTTTGCTGGTGCTCGTCCCTCCACTGCG
TACCCCCTTCGCCATGTCGACATGCATATCTTCGTGTCGAGCACCGCGCTAATTTATACCATAAACCAATCAGTAGATTTGTACACTCCAACGACTTCCA
CGGTGCTAGGCAACCGGGCCCGTAGCGTGCTGTCAGCAGCACAACCAGAGTGATGGTCATCTACTTGAACTTTTGTTGATTGGACACTAAACGTGGGGCC
CCGGTTCTCTGACGCAAAGACACGGCCAAGGAGTCGTAGCCATTCGTGTGCATTAATCCTCGCGCCGCGCCAACACCGACATGACCGCTGCAGGCTTCTC
CATGCCGACTGGTTACAGTCTGGCAGCCAGTTACTACTGCCTCAATGCAAGCGGCGAAATTACCGACGTCGTCGTCGACGTCCAGAGGCCATGTGAGACC
GTCGAAAAACGAGTTGAACAAACTCCCGGCGATGCGGTGCAAGTGCCGCGTCTGCGGCTGAGTGACCTCAACTGGAAGAACCGCGCTCGTTTTCTGGAGA
TGATGGAGCGCCACTCGTTCGTGGTGCTCACGGAGCTCGGTGAGACGCTGGAGCGTATCCACGACCGAGTGCTTCAGGACTTTGAGACCTTCTTCACGAG
CGACGATGACGAGTGGAAGAACGGATGCACAAGCAAACACGTGTACCGCAACGAGCATGGCAAACCGTTTTGGTACTGCGGATATGAGCACACGAGTGTG
CGTGACTGCTTCCGAGTGGCTTGCGGGGACATGTCGAGGCTGGTGTGGCCGTCACCAGAGTTTAAGGACCACTGGCTGGGTCTGCAGCGCCGCATGCAGC
GCATCTGCGACCGTGCATTGAGCTTGACTGTCGGCTATGATATTGAGCCGAGTGGTGCGCGATCGGACAAAGACTTTTCGGTTTGCTACGGATTGCACTA
CCCGAACATTGAAGGAAGCGGCCAGTCCGAGACGGAAAATGTGTTCGAGCATATCGATCCGAGTCTGTATGTTGTGGAGCCTGTACCGAGCGTGGAGGGA
CTGGATGTGTACGATCCTCACTCCAAACAGTGGCTTAAGGCCGAGAAGGTGTGCGTTCCGGGTAAGGAGATTGTGCTTTTCTGTGGTCATGCTCTGCATC
GAGCCACGGAAGGCCGCATCCCAGGCACGTTGCATCGCGTTAGGCGCACCCCCGACCGACGATTTTGCATCATTTACGAGCAGAAGTACGAGGAGTACTT
CCTTTGAGCAACATGGAGGCACCTGATGGAACCAAATGAACGTAAAAATGAAATGCTAAGGGATTGTTCCAACGTATGCTGTCTTAATCTCAGAGTCTGC
GACTTGATACATGTGGAAACCAAGCGAGTTTGCATCGACACACGTGAATGCCGATGTCGTGGGCTCATGAACAACATGTATTTAATACAAGTTTCGCCGT
AGTTGAAAGTTCCCGAAGCAGATCCTGCCCAGCATCCACAGATCCCCAGCTGATCGCGTGGCAAGACTGCAGCCGACTTTTACTGTCTGGACGAGAAAAC
GAGGCAGCGTTATTATACTCGATAACGTGTAATCCACGCATCTTACACGCTGCAACCCACGTTATCCCTTCCTGTGTGCGCAGATTGCGGTAGCGACCGA
ACTGTACACGGATTGAACAGGTTCATTCTCTGCTTATACAGGTATGTACCGAACTCGCTCTTCATTCACCATTTTGCTTCGTGCGAGAGCATACTGGTAC
TGCATCCAAGAAACATGTTCACGACTGCATCGATTGCAAGCTCCACGTTGGCCTGGGCACTCTTAACCGCCCAACCTTCTCAAGTCACACGATTTCAGTA
ACGACGACGACAATGCTCGAGTCCTGGGAAGGATGGGGAACCTCGCTCTCCTGGTGGGCCAACGTCTTCGGAGACCGCGAAGACATCGCCGACATGTTTT
TCACCAACGTGTCGTCGGTGTCCATTAATGGCGTCGCAGAGGACATTCCAGCACTCGATTTCAACATCGCACGCTACAACATCGGCGGCTCCGGTAATAA
CGTCATCGATGATAGTGGAACGGAGATCGCCATAAAGACGTCAGAGAACATGCCGGCGTTCAATGCAATCGAGACGTTCTGGTTAGACTGATGTCGGGTC
CGTGCTGACCCAAAGAGTTGGAACTGGGACGCGGATGCAAAGCAGCGAGCAATGCTTGGCTTGGCATCGAAGCGCAGAGCCGACGTATTCGA