Description :
From Genome Similarity Track
Location :
Scaffold_251:15505- 17344
Transcript NameFunction/comments
Phyci_19027Hypothetical protein

Sequence
1839 bases(100 bases per row)
cattcgttggtcaagtctgtcgtccagtattcgctcgctgctacggagtagtgccgatgacacttcagcgctacaagaaacggattcgtgacggcaacat
gcccgtcaaggatcacggaaactagctcaacaagaacgcggctcaggtcgacgtggtttggctagtgaagtggtttaccacctttgcagaggaggttggC
GAGGTGGCCCCAGTGCCCGTTCGCATGCAGAAAAAAATTGACTGGACTGTCCAATTTGTAGAGTCCGGCCTCATGGTGCGcgaacccgcaagagttatga
tgcggaagcttcttacgctacactgccctacgatttggattcgctctccgcgcagcaacgtcgtgatatttgcgctatttaccacgctgggatgtgcggc
ggtatcacgacagacaagtcagaggctctcggtcgccataccgaatccgctcggcaaatgcggtaagttttgtatggggacgtaagtgacattttgattt
atttggaataagtaacgtggatgttggtaacattttgacttacttataggcgcgagtacaaaggtgacaagtcttcctgctctagcgagcacgcggtgat
tgtaaaggactactatcaaaacttgactatcccaagcgtagccaatacgccgtctcaatggtatttttgctcgctgctgtctgtgagctgtttcggaatt
tactacgaaaatgaTGGAGTTCAAACAAACTACATCTACGATGAGGGTACCAGTGCCAAAGGCAGTGATCAAATCAATTCGATGTTGACTCATTTTATAA
ATGCAAAGGTCGTACCGTCTGGAAAAACGAATCTCACTGTGTATGCAGACAACGGCTCGGGTCAAAACAAGTACAACTATGTGATCAAGTTCTTGCTGAC
CCTCGTTGACATGGGCATTTTCGAGCACGTGGAATTCAGGTTTTTCGTAAGAGGACATACGAAAAACTTGTGCGATGAAGGGCTTAAAGTCGGATGTAGA
AGAGCAGGATTTACGATGAAAGATTGACGGAGTATTGACGGCGAAGGAGAAGGTGGAGCGAATCATGACAAACCGCATCGAAGTCACACCTCCGCCGCCA
GTAAATGCCGAGAAGAAAGAGCAGATGtacaattctattaggccgttcgtcccggacgaatttcagaacgaccctttatacgcaaagccgagtaagaaag
agggagctactgcaaagtcggcgaagcaaggtcgcttagcgcatcgcgctgcgatggcggcggcagctaatatgaatcaagacgggggtggaatggctga
cgactcatccgacgcagagccgtctggaaagaaaaagcagcgcgaaagaagagaggagtgccaagcaagaagcctgcaccaaagaccaaaaagcacaaat
ctctagcatcggacagtacagatgcgtaggtatgagagagatgttcaccattttgttgcttacgtccactggtaattcaaaatgttactttgtgactgaa
gtcaaaaattgaaaaaatattcaaaaaaaataaccccatggatttgtaatgaacagaGAAAAATGTTATTTTCGTGATGTTAGACATCGATTTAGTTAAT
TCTGAGACCACCACTGGATACCTCGGGTGATTTTACTCTAGAAACACAAAAAAAAATTTtgagatctcgactcgaaaatggagataatgtttttgctggc
ctcgtcctctgcttcatcttcatcaatttggctGTGGagtagctcaaaagatagctaatatagccctctttccaacggtgtccctaaatcgcgattcgta
cgttggttgactagtatttttttgtttgctgttgtctca