Description :
From Genome Similarity Track
Location :
contig_61:155023- 156591
Transcript NameFunction/comments
g9201.t1hypothetical protein

Sequence
1568 bases(100 bases per row)
AGCCCACCAATGCACACCATCTTGGACTCGAGATACTCTTCAAGACCTTCGGGCGAGCCCTCGCGGCCGATTCCAGACTCCTTCACGCCTCCGAACGGGG
CTTGCACGATCGAGACCACCCCCGCGTTAACTGCCACCATCCCGCTTTCCAACTCGCTCGCAACTCGAAAAATGCGAGACACGTCCTGGGTGTAGAAGTA
CCCTGCCAGCCCGACATCCGTGTCGTTCGCCTTGCGAACCACCTCTTCCTCGCTCGAAAACGGGAAAAGAGGCACCACCGGACCAAAAATCTCCTCGTTC
CAGATTCGCATCTTCTCGTTCACGTTGGTGAGGACCGTCGCATCGTAGAAGTTTTTGCCGATGCCACTCATTTTCCCTCCAGTTAGGAGCTTGGCCCCGT
GGTTCACAGCGTCATCCACTAGCGCGGCACTTTTTCGACGGCTTCAGGTCCGATCAACGGCCCCAGCTTCACGCCGTGCTCCAGTGGCAAGCCAATCTTG
AGATCTTCGACTCGCTCGACCAACTTGGAGGTGAATTTGTCGTAGATGGACAAGTGGACGAAGATGCGGTTGCAGGTGACACAGGTCTGTCCGCTGTTGC
GAAATTTGGCCGCAATCAATCCGTCCAGCGCTTTCTCGATATCGGCATCTTCAAAAACAATAAACGGCGCGTTGCCACCCAGCTCAAGAACTACGCGCTT
GACTGTTGAGGACGCTTGCTCCAACAGCTTTTTGCCCGCAGGAGTAGATCCAGTAAACGCCACGAGACGAACATCGGGGTTCGTCGCAGCTCTTTCCCAA
TGCCCGAGTGGCTACCGCGTGGAGAAGTCACCACGTTGATCACTCCAGCTGGCACTCCTGCATCTTCCGCTAGCTTGGCAAGAGCGAGCATCGACAACGG
CGTTTTCCCAGAAGGCTTTACTACGGCTGCACAGCCCGACGCAACACAAGGCGCTAGGCTCCGGGTCACTGTCGCGTAAGGGAAATTCCATGGCGACATG
ATCGCGCACACCCCCACAGGTTCCTTCATCACCAGCACCTTCTTGTCAGCGTCCGACGGAGTAACCAAATATCCGCTGGAACGGACGATCTCGTGAGCAT
AGTACTCAATAATACCAGCAGTGAACTCCACCTCGATCCTAGCCTCCTCAAGCGGCTTGGCGCTTTCACAAGACGCGATAATCGCCAGGTCTTCAGCATT
TTCGGCAATTGCAGCATGCCATTTCTTCATCACGGCTGAGCGGACCTAGTTAGACAAGGTGACAGCACAAAAACGTCAAAAAGCGTGTCAAGGCTTATTT
GCTTCTCAAACCGACCGGCGGAGTAGCTTTCTTCCAGCGACGTTGGGCCACGAACGCTGCTGCAATAGCCTCGTGAGCTTCCTCCTTCCCCATACAGGCC
ACTTGAGCGAGTTCTTCATCCGTGGCAGGATCTAAATCGCTCAAGAATGAGTCAAGTCTGACGAATTGGTCTCCATACAGTTATCTACTTACCAACGACG
GCGAAGTAGTCTCCTCCATGCCCTTCGACCCATTCGCCATTCACGAAGCCCGTTGAGCGTACGAGCTC