Description :
From Genome Similarity Track
Location :
Scaffold_1813:155- 5967
Transcript NameFunction/comments
Phyta_totarag13699reverse transcriptase

Sequence
5812 bases(100 bases per row)
CGTATTACCGATGGCCAGTGACGCTTCCAGCGTAGAGCGCGGATCCCAACCGTGCACGAGATAAAACGGGGTCTCGTTTCTCGTACGGTCGTGTGCCGTG
TTGAGCGCGAAGGCAAGTCTCTCCGCGTATTCATCCCAGTCTCGCTGATCGATGTCCGCGATGTACATCTTAATGGCCCTCGTGATCATTTGCACCATAC
GTTCTGCAGCGCCGTTGGCTTGGGGCCTGTATGCAAGCGTGGCTCGCTGCCTCTGGCCCATGAGTTTGCTGAACGCCTTGAAGAAATCGGACATAAAACC
CGGCTCACGGTCGTGTCGGatcgcttcgctcgcgcCGAATCGTCTGAAGACGGTCTCTTCGTATGCTTCCGCAACTGTCTGCGCGGTCCGTGACGCATTC
GCCTTTACGATAACGAAGCCTGTAAACAGGTCGACCCACACGAGCAACTCGGCATTGCCCTTGTAAGACACTGGCAACGACGGGATGTGGTCCATGACCA
CGACTTGGAACGGATACGTCGCCACGATATTGCCTGGCGACTCGCCTTGGATCGTCGGTCTCCCCTTTCTGGTTTCGCAGTCCGTGCACTCGCCCACAAA
ACGTTGCACGCTCCTGAAAATCCCTGCCAATGGAAGTGGCGTCGCAGTCGCTGATATGTCCGGCCGATTCCTTGATGGCCACCTTCCAGGCTCGCGTGGT
AGTGATACAGGACGTCCTCGTGGAGCGTCTCTGGGaccaccagcttcatgaTCGTGTCGCGCTCTTCAGCCGGTTCGTCTCCTCTCACGTGGTAATACAG
TAGttcgccttcaccttcttcataTTGGTGGgcgatcttgctgcagttcttcgcCTCCTGCCTGGAGAGTTCTCCGATATCGCCGTTCAAATACTTCTTG
AGGTTCACGATCCAcagctcttcgtcttggACGATCCGGATGCGATCTAGCCTGAGTCACTATACGACCAGCTCCTGAAGGACTTCCGGTGTCCTAGCCG
GGGTTGACGGGGCCCGTGTTGCAGCAGACCGGGCGGTTACTGCTTGCACTTGTGCCGCCCCGAGTTTCGTGTCGGCGCGATCTACCGTCGACTGGCGTAA
ATCGGGCGTCACTGGATCGGGTCTTCTAGGTCAGACGATCTCTCCGAGACGATCCAACGTCTTCAGATCTTGGATTTCCTCCAGGCTGCGGACCTCTATG
CCGCCTTGACGTTGCAACGCCTGTCCAGCCAGCATATCGGCACTCGCGTTCCAATCTCGACGTACGTAGAAGAAGTCGTGACGGGGCCATTCTTGTAGCG
CGTTCCGGACTCGCTGCCGGAGAAGTTTCAGGCCTGGTGACTTGCAGTCCATCTCTTCTCGCATTTGCTGAGTGGCGAGGTTTGAGTCTCCGCAGATGAT
CAGCCTTGAGACGTTCAACCCTTCGAGGAGCGAACATCCGAGCAGCATACCTTGGTATTTCGCCTCGTTGACCGTAAGATATACCGCGTATCTTGACGCA
GCACGGACGACTTCCCAGCCTGGTAGCTTCCAGATGATCGCGCTAAACGCTCCACATACTCGCTTGGCTTTGGCAGATCCGTCGAAGCTCATCACgtgga
gctcttcctccgGTGTGATCGCCGGGATTGGGATGACGGCAATTCGCGACGGACGCTTGCCCGGTGCGATCTCTTCCAGGACGGTATCCACGAAGGGTCT
GGGTGTGATGCTCGCGGCTAACTCCCCAAGtatctcttcttctcctttcgtGGACCGGTGAATCTCCAGCGTCCGTGGTGAGAGTATGGCGGTCCATTGC
GACAGTCGACCTTGTAGTCTTTGGATCGGAACAACCACACCAATGTTGTGTGACGGGTCAAGCCGCGTATCGAGTTCCCAGCCAGCATCGTGAATCAGTT
GTTGAGGATGCgcagcaaggccaagatctccttctcgacgatgTCATAGTTCAACTCGTTGGGCTTCAATGTGCGACTGGTAATTTTAACCGGCATGTAC
ACGCCGTCGTGAGCTTGGGTGAGGACTGCCGAGATTGCCCAGTCGCTGGCGTACACGATTACGACGGGCTCTCGGGATAAGTTGTAGTGCTTCAATATCG
GGGCCTCGGCGATCTTGTTCTTGAGGGCCCCGAATGCACTGGACGCATGTCTCCACTTCTCCTGTTCGCGGACTTCCGGTTTCGCGACgtagtcgtcgaa
gtcgGTCTCCGTGAGCGAGTACAATATGGTCGCGTAGATCGCGAAGTCGGCGGTGAACCGGTGGTAGTAGTTGAGACTGCCCAAGAAGGATTGCAGGCCT
TTGAGTGTACGCGGTAATTCTAAACTCGTGAGCGACTCCAGATTCTTCGGCTTCGCTTCCAACCCGTGCTCCGACACCTTGTGACCCAGGTAGTTAACCT
GAGACATTTCTCACGTTCTCTTCTCCACACTGATGGACAAGTGCCATTGTTCGCAGACGTCCAGCAGGCGTTCCGCCTTCTCGCACAAGTCGTCCCATGA
CGTGCCACCGATCAAGATATCGTCGATGTACGATCGACGGCCTAGAACGGAGTGGATCACCGGAAGTTCCGGCTTTCCTCCGTCGAAGACGTCTCGTGTA
TCCCGATCTGGGGTCAAGCTCCAGAAACCATAGAGCGCGTTGTCGATCAGTCGCTGGTATATCTGTGGCGCGTTACACAGTCCGAACAGCATCCGTAGCC
ATTCGAACAGCCCGAACGGGGTGATGAACGCCGAGATTAGTCGGGCCTGATCTGTCATGGGGACTACCCATAACCCACTGGCCATGTCGAGGGAGCAGTA
CCACAGGTATTTATCCAAATCTCCCAGCAAATCGTTGACGAGCGGCATCGGATATACCATCAGCTGCGTCAGCCCATTTACCAGTCTGTAGTCGATGCAG
AGCCGAATATCGACcccgttcttcttcacaatCACTACGATGGATGATGCCCACGGAGAAGTCGACAGACGGATCATGCCCGCGCTGAGCAGCCCCTTGA
GCAGGTCAGAGACCTTCTCTTTGAACTGAGGTGGGAGCTTACGGACGCGTTACGCTATGGGCTTAgcgtcgccgacgtcgaTATCGCAGACGACCCCTAT
GGCAGCGGGCGGGTTTGCGGTGCCTTTCCCGATCAGCCATTTTCGCCGCTTCCAGATGATCCGGCGCAGCCGGTCTTCTTCCTTCGTAGCTACCTCCGGT
ATGACCCCGGCTGGTCTTCCGACTTTGAGATCTTCGATCTTCACTTCCACAATCAGAGAGAGTTCTGTCAGAACGGCCATTTCTCCCTCCAGTTCTTCTG
CGAAGAGGTCCGACCCTTCGTGGAAGAGTACAGCGTCGTCAGCTTCTACAATCTCGTTTGGCCCATCCGACGCGGTATCCACTGGCACCTGATTCAGAGG
ATGCATTTCTTCCACTTTCTCCCGTTGTTCCACGATGTCGCACTTCTGCGGCTCTCGCGCTGACTCTTCGCATTCAGACGTACGCGTCGGTTCTGCCGCC
GTAATCGCAGCAACCGTTGGGGGCGACTTCCGCTGGCGTTCCACTGGGTCTTCCATCTTCCTTTCACCTCGACGCATGATTCCTCTGGGGGTTTCGTGTG
TCGGGCGCTCAATCATCGGTCCGTCGGGTTTGGCAGGCGTCCAGTCTTCGCCCGCGTCGCAGGTGGAACCGTACGCGAGGTTCTGCCACTCTTAATAGCG
TCGCGACTCAACTTGtacgaagccgaagccgcgTGGAATGGCACCGACGGGCGTCCACCAGCCCAGCGTCATGTGGGCGTCGAGTGTTATTGGCTTGTCA
CCGATATTGGTCACCCGCAGGTACGTTCGTCGCCCGATCTAGCTCTTCACGAAGGTGCTCACCCATGTTTTTCCTCGTGTAACCCATAGTCGCGGAGCGT
TCCGGTCTGGTCGCAGGTGAACGTCGTGCGTTCGCCCCgggtcgatcttctcgagcgACGTCAGGGTGATTGGGCGCATCTTCGCACCGTACAGCGGTCT
TCTTCCGATCATCTGAATCCGCACCTCGTCGGGCAGGCACGCCGTGCCGTCCGCGGTGTCGATGCGCACTCCGGCTGGCACCATGAAGTTCATGCCCAAG
ATCGCGTGTTGGCCCACTAGGTCTCCGACCCAAATGTCTAGGAAGTAGACCAAGTTCCCCGCTAAGGTAATTTTGATCCGTGTCTTCCCAACCGTGTAGT
ATGTTTCGTCGCGGATTCCCACACAATTCTGCGTTATTTCCGTATCGACCAGACAGCCTACCTCACGAGGAAAGGTGGTGTCCAGTATGGACACCTCGGC
ACCTGtatcgagcagcaacgtaGCACGACGGTTGTTCAACTTCCCGTAGATCTTGGCCTGCCGATACCACTTGTCCGGCGCGTAGTAATTTCAGTATCCG
CGTCGTTCTCCAGGCGGCAGGTCGATCACGTCCAGCGGCGGCTCTAGCGCGTACTCGTCCGGGAGTCGAAGGTCCACGACTCGGGGAACGTGTTCTTGCG
AGGCACGCTTCAGGTTGGATTCACATGTATTATCGATCGAGGTATCCGAGTCTTCACTAACCACCTCCTGTGACTTCTTGGTCACATATGCATAGACGGA
AACAGGTGGCTCGTCTCGATCTGGTTTCCAAGCCAGCCAGTGATCACGTTTGACATATTTCGGCCACCAGTGGCAGCATTCCAGCATGCTTCTGCCGGTC
ATACCACTGGCAAAGCTGGATGAAGAATTCCTCCATGGGACATTTATCGGCTTCGTGCACGTCTCCACGCGTGTAGGCATCGGTCCGTCGGGTGATGGCC
ACCGCACTTCTGACAGGTCAATAAGCTCCAGCAGTCTCCGTCTGAGTGACGGTATGACTTGCACTGGCGGCACCGCGGCTTGTCCCGCCCCAAGTCATCC
GCGTCAACGCTACGACGTGCGTTCTTGTCCGGCGGCACTTGGCCCGTCACAAACAGCTTGGCCCGTTCGTcgcctcgatcttgatcGTACATCTGATCGT
CGGTGCCGCGGTCGTCGCGCCCGAGTCGTATCCATCCGACGCGACTTGGACCGCGTGAACCGCGCGTGTCGACGCCTTCTGGCGGAACTTTCTAGATCCA
AACAaggtcttcttctggtgaGCGAGTCCTCGCTGCCGAGCGCGTAGCTTTTTCTCCAGCGTAACGATATCCGACACTTCCATCAAGGTAAGTCGAGAGG
CcagttcttgttcttgtgaACCGAGGGTGTTGATGAATAACTCCACGTGCTCTCGTTTCTCCTCCTTTGTGCTATCAGATAGTGGATCTTGGCCCGCATT
CCCGCGACTTTAAGTCAATACAGATATTCCAACGGAGTCTCATCGGGATGTTTGGTGGCATGGTAATACCGACTCGCCATAGACACGCCTTTGCCGCAGT
ACTGGATGCGGAACTGCTCCGTCAGATCCGTTCACGGCTTCTTGACATCTCAGCCCAGCTGCAGGTACCATTGGTGCGCGGGTCCGGTCATCAAGTCACA
GAACAGGGCGCACACTTCGTCACCGGTCATGCCGTCGCGGCGCGACGCTGACTTCACACGGTTGAGCCAGGTCCGGGCCTTCTCTTCGCTGGAGTCCCGA
CCATGGAACTCCTTCAATTCGGAGAACGCGGAGAGGCGTACGCGGGTGACAGCGACTCCAGTGGTGccggccgtcgtggccgagATAGTGGCAGCGTTCC
CAGACGTACCGGTTTCCAGGTCGAACAGATCGTTCGGGTCCTCGTCTCGGTTGCATCGAAGACGCGGGGATCGGGACGTGGAGTGTGCACTCACCGACTC
Catggccacgtc