Description :
From Genome Similarity Track
Location :
Scaffold_2172:155- 3199
Sequence
3044 bases(100 bases per row)
ATCGTCAATTGTGACCTCCTCTGTGGTCAGTGGCACCTCCGGGATTACCGCCAGGCCATCCCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAA
CAGACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAACACCGCGACCTGGCAGTCCTTCTGTCTTCGCGGGAAACATGGACACCTGTAT
ATCAGGGAAACACCCAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGCCCGACCGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATTCAGGC
ACTTATCCAATGGAAAGCTTGGATCCACTTGTGAATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATC
TAGGGGCCGACTCTGGGGATCATCCCCGGTCTTGGATCCAACCTCCCTTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTGGCGGAGTTGGA
TATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTGCGCCGGGAGCTCCACCCCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCC
ATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAA
TAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCTGAGTGACCCACAGT
TTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGTTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTTGCTC
CATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAAGAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAA
ATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTC
CCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCATCCAACCTTACGAGCAAAGGCGGTATCTAGTA
TAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCATGGCTTGTCTGAACCACTTTCCTGGGGCATGGTA
CTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCA
GTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCATCTCCCCTTTGTAGATCCATGGTTGAAGAGATTT
CGGATCTGGCAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACATGTATTATCGACTGGATCTAGGGTCCTGCTA
CCTGGATCTAGCGATTTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCGTAGTTTAACAT
CTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCG
TGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGGCCTTTCTTGCTACACTTCTCACAGACCAGGTGTTTCCAGCATCCAGATT
CAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACAGTATC
CCCCGATCGCGAGTTGTCTTTGGTCTTCGCCGTTCGATCGTTGGATGCGGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGATCCGTCGGAT
CCTGATTCAGTCCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGAGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCG
CCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACCTCTCAAGCTCGTCTGCGTCGGGAAGTCGTACAGGTCAGCCTGTCGGCCATCCT
TGATCTTCAATTTGGCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCC
ACCGACACTCCCAAGCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGG
CTGGCCCCGCTAACAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGC
TCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGATCCGGCTGTG
GCTGTTGCTACCACCGCTGATGAAGGGGATGGGCCATCCAGATCATCTAGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGT
CTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTCTCATACCCTGTTCGACCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTG
CAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGATCCGTGCGGCGATTACCTTGAGCCCGATCTGACGATAAT
CCCACTGGCTTCTTGTCGGATCTGGCTCGATCGTGGCTGGATTG