Description :
From Genome Similarity Track
Location :
Scaffold_2368:155- 2612
Sequence
2457 bases(100 bases per row)
TCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACT
TGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGCTTCGCGCGATCCACAGCCCGCAGCACTTCTTCAAGCTCATCTGCGTCGGGAAGACGTAACAGGGT
CAGCCTGTCGGCCAGATCCACGTCCCTCACCGTCTCGATGAAATGATTCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCC
CGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGTGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATGGTCGTGCCACCGACACTCCCAATC
CACTGTACTGGGTCTGGAAACGGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCCGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAG
ATCCGCAAAGGTCAAACACTTCTCAGTATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGA
TCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTG
CTGACGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTC
GTGGAGCACTTGCACTTGTGACACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAA
GTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGC
CGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGAGCCTTCACGTT
CACAGGGGCTTCCTGTCCTCGGATCCTCGCTCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTATCTGAC
TCATCCTCAGCGGCGGATTCGTAGTTCGAGGGCGCAGCTTGGCTGACCCTCGGCGACGACACCGAATCCATAGTGCGCGACCTTTCTCCGATGATGGACT
TAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTC
CGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTC
AGGATCGGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTCGACCTGGATCCAG
CTTGGTCCTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAG
GTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCA
GGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCC
ATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTG
GGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTT
ACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATC
TGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGGGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTG
CGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGGTCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCC
CTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCTGGGACGGGTTCTGGAG