Description :
From Genome Similarity Track
Location :
scaffold_207:155- 1583
Transcript NameFunction/comments
g5659.t1 Gag-Pol polyprotein

Sequence
1428 bases(100 bases per row)
AAGAACGACACATGGAATGTCGTACCATTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATCG
AGCGGTTCAAGTCGCGACTGGTGGCCAAGGGATTTCTGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCGCCGGTGGCCAAGTTCACGTCCATCAG
GATTCTGCTCAGTCTGGCTGCCAAGAACAACCCCACGTTGCATCAGATGGATGTCAAAACAGCCTTCCTCAATGGCTTGTTGGACGAAGACATTTACATG
GCGCAGCCGAACGGGTACATCGATGAAGTCCACCCGGACTACGTGTGCAAGCTCAAGCGATCGCTGTACGGACTGAAGCAGTCGCCGCGAATGTGGAACA
AGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGACATGCGGGTCCGACCACTGCATCTACTTCAAGCGTGACGGCCAAGACATGATCTTCGTGGC
GCTCTACGTCGACGACTTGGTCCTCGCCAGCAGCAGTGACAAGATGCTCAAAGAGACGAAGCAGGCGCTCAGTGACCGGTTCAAGATGACCGACATGGGT
CAGCTCAAGTACTTCCTCGGGATGGAGATCGAGCAAGATGTGGCGACTGGGAAGGTATCGGTGCGGCAAACCAAGTTCGCCAACGACATCCTGAAGAAGT
TCAACATGGAGAAGAGCAACCCTGTCAAGACGCCGCAGGATCCGGGTCTCAAGCTGACCAAGGCCATGTGTGAAGGAGGCTGCATGCACGACGAGACCAT
GGTAAACGTGCCATACCGGAACGCTGTGGGATGCCTCATGTATCTCATGGTAGGCACACGTCCGGACCTCGCAGCGGCAGTAGGAGTGCTAAGCCAGTTT
GCAGCGGACCCCTGCCCGACACACTGGCAGGCGCTCAAGAGGGTCTTCAGGTACATTCAAGGCACGAAGACGCACGGCATCGAGTTCCAAGGAAGCTGCG
AGGACGGACTTCAAGGCTATTCGGATGCGGACTGGGCAGGCGACATCGAGTCTCGACGGAGCACAAGTGGCTACGCGTTCATGATGAACGGCGGATGCAT
CAGCTGGAGAAGCAAGAAGCAGCGGACGGTGGCACTATCGTCTACGGAAGCGGAGTACATGGCGCTGTCAGAGGCAACGCAAGAGGCGGTGTGGCTCAAG
GTGTTCCTGTGCGAACTCGGCGAGATGGCAAACGATGAAGCGGTCAAGATCTACAAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAATCCCGAGTTTC
ACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAAGTGGAAGACGGCCAAGTGGTACTGCAGTATGTGTCGACAACGGACATGCT
GGCGGACATCATGACGAAGTCAATTCCT