Description :
From Genome Similarity Track
Location :
Scaffold_836:155- 1500
Sequence
1345 bases(100 bases per row)
CCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAATAGCTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAG
TACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTCGACACATACACTACTGGTTAAAAGCGATACCTACTTCGGTCAGGCAGT
TCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCACCGGTGAGCTAATTTCTTCGTCAAGCCCGATTTGACGCGTTCCA
TGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTG
TTCATTTCCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTCGACTCAGAGCATAATGCTTTTTAGCTCTTCGCTCCTTTTCTACAGCCTGATAATCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTG
CCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGTGTTTCCTTCCTTGTAGTGTCCTGAGAAGTATTAATAGCAAACACCAGCTTCTC
TGCGATTTCATCCCAATCTTGCTGTAAAAGGTCTTCCGCGTACACCCGTACGGAACCCATCACTGACTTCACCGAGCGTTCCTGCTGTCTATTAGCCTGT
GGTCGATAGCTCAAAGTCGCCCGTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCACGGTCATGACTTATTA
ATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
GAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACCAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCT
AGTCCATTTCCAGGCGAGTACCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCCGGACATGACCTCATATGTCTTCTCCACGTCAGCGTACAAG
CCGATCCAATAATAATCGGACTTAACGCGATGGAATGCTCTCACCACACCTTGATGTCCACCTTCCCGCGAGTCGTGACAGCTCTGTAGGACCTCTTGAA
TCATCGTTGTCGGTACTACCAGCCGCAGCTTCGTTTCCTCTTGCC