Description :
From Genome Similarity Track
Location :
Scaffold_1905:155- 1288
Sequence
1133 bases(100 bases per row)
TACTGCACGTGACACCAGCGCAGGATGCAAACTCATCTAGTTAACCGAGGCACCACGCCTGACTCGAATTTGTAGAGGCATCTCACCAGCGAACACGCAC
ACAGGACGGGCGCCAAGTTTCAACATGAGCTCACGCCATATACACACGTGCACTGTAGCATGGCACCAGCGTCATGTTGAATACTGCAATACTCTAAGAA
TTCTTGCAAGCGACCAAACACGCCTACCAAAGACAGAGCTAGCTTGCTTGACCAGCAACTGGATTTTTACTGGCTCGGAATCCAATTTCTAGGCGAAACA
GAGCAACAACCAGGAGCTGCAGCATGGATCCACAGCACCCCGAGCGTGGTGGCGTGATGAATTCTCCATACCACGTTCGTTCATTTTCCAGAGGGCTTCC
TACATCCAACGACGAGACATAATAATAATAAGAAATAATAATTATGCAGTGTTATTACTTTTTCAAGCTCACGCACGGCTCCTTCTTTTGGTATGCAGCT
CATATCTTAATAATATTTGCAGTGTATTGTATGTAGTTCCAGGGGGTTTGGTGCGACCACCTCATCCAAGCACAGCGATGATGCAGTGCGAGCGAGCATT
TTAATTTTAATTTCCCAGAGTGTCCACCTCATGTGCAACAAAGAGGTCTCGCAGCGAAAAGAAAGACCCAAGCAGCAGCCAGCTGGGGATGGTGAAAAGT
GGGCCAATCTGCGCCTCCAATGACCCACTCACATACGAAAAGCAAGTCAAACCTGGCGACCCAATACCCCATCACCTCTTACGAAAATATGCGACGGGCA
TCTCAGAGACAGGCCAATTTCAATTTGCTCCGTCTCTTTTGAGAAAAAACAAAAGATCTCTTCAGTTTAAATCAGCGAACTAATCATTGAAAATAAAAGA
TATTATAAAATCTTATATAATATAATAAGAATAAGAATGGTATTGCTATCTTAGACAAAGCAACCCTAGAGATCCCTAGTATTTTGCTCCATTGCTGCTG
TTTAAGAATCTGCACCTTGTGTGGTTGTGGACTGGACAAGCAGTCGAATCTGAACGCTTGAAGTCTGGTTGCTTGAGCTGGAACGGCTCTCACTCACATA
CCTCCACCAACTTGATCGGAAACTGAAGCATTG