Description :
From Genome Similarity Track
Location :
Scaffold_138:15495- 19887
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_138-abinit-gene-0.48Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_138-snap-gene-0.19Protein kinase

Sequence
4392 bases(100 bases per row)
GCGCTAACGGCGGTGGTGGTGCGCGGTGACGGCGACCTCGTGGGGAAATTCTACACTGCGGAGAAGAACGGGCTGAGCACGGATTTGCTCGCGATCACCG
ACTCGCAGCTCTCCAGCGACGCGAAGAGCCGCCTGCGAGACTATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGCGCTCACGGGACTGC
AGCAGCGCGCGGTTCTCTGGGACTCGGGGCTTGTGCTCACGTCCAGCACGTCGCTGGTGCAGATCCTCACGACCTGCACGCACACGATGAGCGACATCAT
GCTCGACTTGCAGGTCGTTACGCAGCTTGTCACAGTGAACAACAGCAGCACGTGCACTATGTCCAAGTGCGGTGGGAACAGCCAGTTTCTCGAAAACTGT
CCGACAGATGTGATCGCGACCTCGACACGGTGTGTTGTAGACACGTCGACGCTGGCGCAAGTGCAGACTTCGGAAGGCGCGTACTGGGCAGAAGACGGCG
GGAGCGACGCGATACCAGCCCCGATTGTGAGGGATCACACGACGTCGACTGCAGCGACCAAGCTTTACGCGATCCACATCACCGACAAGGCTTTCATCGG
AACCAGATCTTGCGAGCCGAATGGTCGAATTATCATCCCGTGCCGAGAGAAAACAGCGAGCGATACAAACCTTTGTACGCCAGCAAAGGGGCAAACGCTG
GACGCGTGGCTGAGATATGTGTCAGTACCGGCGCCAGGCAATTTCTCAACGATGTCGACGACAATGATCGTGCTGCTCCTTGTGGCTTGCGTGGGGCTCG
GCGGTGTGATCTTTTTCCTGATCAAGTACAGGATTTTTCGGAAATCAAGCAACTCGAGTGAGAATTCGCGGACGTCGAACCTGCTATCTCATGAACAGCT
TCAAGGATCCACTCCGATGGATGTGTTTGCTCGCTCAGGAGGGCGAGGAAGTCGTGGCGTCGACCCTACAGTCTCCAACGACGCGCTCTGCTCCAAGTCT
ACGATTTTGCGCCGATTTGTCGCAGACCCAGCCATCATCACGAAGCGCATCTCGGTTTCGCAGATAACCTTTCTGCGCGTCTTGTCTAAAGGAGGCAATG
GCGAGGTGTGGCTGGGCCAGTACGAATATCGGTACGTTGCACTGAAATGTCTCTTGGCGTCGAAGCGAGAAGATATTTCTTCTCTTGAGCGGTTTACGGA
CGAGGTTCGACTCGCGTCGGTGCTGGAACACCCAAGGATCGTGGCATTTTGTGGCGTGGCGTGGCAATCGCTGCTGCACCTGTGTGCGGTTACCGAGTAC
CTTGAGAGAGGGGACTTGGAATCAGTGCTGAGCCAGTCAATTGCTGCCTCGCTGACCTGGGAGAAAGAGAAGCTGCTCATGTCGGTGGATATTGCGGAAG
CGCTCGTGTATCTTCATTCGTTGGAGCCAGTGATTATCCATCGCGACCTGAAGTCCAAGAACGTGCTGCTTGATCGGCATTTGCGAGCGAAGCTGAGCGA
CTTCGGTCTGAGTCGAGAAACGTCGATGGAAGACACGATGACGAATGGCGTTGGGACTATTCTTTGGAGCGCACCAGAAGTCCTCGAAGGGAAGCGATAC
GACGAAAAAGCGGACATTTTTTCGTTTGGCATCGTGCTGTCTGAAATTGACACGTGCATGCTGCCGTATGGGTTCAACAAGGATCGTAACAAAAACAAAA
TGAAGAGCATGCAGATCGTGCATCTTGTGGCAGAAGGTAAGCTACTTCCAAGTTTCCGAGATGACTGCCCTCCTGCAATTGTCGAGCTAGCATGCGAATG
TCTGGAGCTAGATCCGGAGAAGCGACCGACCGCGATGGAAGTGGTGTACCGACTGCGTTCCAAGTTGTTTCCGTTGCTAAACACCATAGACGAGGTCTAA
CAAGCGAACAAGCCCAAGCCGTAGATGGTAAGATTTATCTATGATATGTATTCATCACTGAGCGAAGGGAAAGCGCAGGGATGCATTGCGGACCTTTTGC
GCTTCCCAATCGTCAAGTGATATCTAGTGCAGCGAGAACGTGACTCTCGCCCCCGGTAGCTCCCATTAAGTGTAATTTAACGATCGTTTACAGGAACTTC
GTGGTTTGTAAGCCACATGTATCCTTTTCCTGTCTGACGCTGTTTGTTTCGTGTGCAGAGGCTTGGACGACGTTGCAGGTATCACATTTCAAGAAATCCA
AGAATGTGATGCTCGATGGTCTGTTGATATCATCATCATCATTGCGTTCGTGCCCAAGATTGCCAAAGCGTCGTCGCAACCCTTGGCGTGGACACAAATA
AACTTACCCTCGTCGAGTCCAGATGCATGGTGGATCACGAGTAGAGTTGGAGAGCTGGTAGAGTCACGTTGGGCACCTGATGAGCTCCTCCGCGACCACG
TCGGTCCAGCAGCCAGTGCGTCCGATCAACACAAAGCAGCCCACACCTCCAAATGGCGGCTCTTCTTCTCCAGCGAGTCCACGCAATGCAACCGCAGCCG
GTGCGAAGGTGAGCCCCGACGCAGAGCGCAAGCGCAAATTAATTCACTTGACCCCGATTTTGAAGCAAGCCGTCAAGGAGCAGCACTGCAGCGAGGACGA
CCTTATCCAAGTCCTCGCGATCACAACTTTCACAGATGGCGAGTACGTGTACTGTCAGGGGCAAGCCGATCGCGAAGTATTCTTCATCGAGGAAGGAAAA
GTGCTGATCACGCAGCGTCGAGCGGGCACGGCTCCTACTCGAGTCGGCGCTCAGCGGCGATCTGTCCAGGAAGCAGAGATGGAGATCCAAATCATGACGT
TTGAAGAACTGGAATACTTTGGAGAGATGGCGTTGCTGCAGAACGCGTGCCGCAAATCCAACGCAGTCGCGAGTGGCGGCACAACGTGCATGGCGCTGAA
AGAAGAGGACTTCCGGGTGCTTCTCGCACCGCTGCACCAATTGATGTTCTATCGGCACCGTCTGCGCTCGCACGCTGTTCTAGAAAAAGATCGGTTGTTC
AAGGATTTTTCGCCAGCGCAGCGCCAGTACATCATCAACCACTGCAGCCTCGAGACTTTCCAGGATAATGACTACATCTGCCGGCAGGGCGACGTTGATG
ATCGCTACTTCATTCTCGCCGAGGGCGAAGCGAATATTGTCATTGACGAGTTGATCCTGAGTCCGTCGCAGTCGAAATCGAACTCGCTGCTGGGAGAAAT
CGGGAGACACGAGAGCAGCGCGATGGCGGTGGGTGCGATGATCGACATTGACAAGCGAGGAGACGGGCGAGGAGGTCGCATTCAGTCGTCGACAGTCGCG
CAGAAATCGCTCTTCCAAGGCTTTGGAGAAATGGGGTTGCTGGATAAGCCACGCACCGCGCATGTGGTCGCGAGGGGCAACCCGGTGGTATGCGTTGTCA
TCACGCGGAAAGACTACATTGCAGCAGGCCAGCTGATGAACAATGCGATCGACGCAGACGCAGAGTCGCTTCTGGCAACTACGCTCATCGAAGAATGGAA
TCTCGTGATCAATGCGCGCAATCTGCACCTGTCGAATCCACAAGTCGCCCACTACCTCATCACATTCATCAAGAAGTTCAAGGCTGCGTACAATCAAAAG
TTTGTCGGGAAGACAATGTACCTGGACTTCTTGCGGCGTCTGCATCAAGAGCCGCAACTCGGCGAAGAGTTCGAGTTCTTATCGTCGCGAGTCACGTGGG
ACGCACCAGCGTCGTCGCTCAGCATTATCCGCTCCGAGTCCCGACGTATCCTCTCGTCCCCGCCATCGCTGCGCACCCCTCCCGAGATGAGTTTCATTGG
GAGAATGATCGAAAACACGGCGTTTCTGGACAAATTCGAAATGCCTGCGAACATCGACAAGCACAAAGTGGCTCGCCACCTTGGCAAGGTCATGGACTTC
CTCAACATCGGTAAAGATATGTACTTGTTCCGCCAGGGCAAGATCGAGAGCAAGGCGTTCATGATTCTTCGCGGAAAGATCAACATTGTGAACGAAGATG
TGAACTCGCTGCAAACTGTCAAGCACTACGAGGTGATCGCGACGCTCTCCGCTGGGGATTCTTTCGGTGAATTAACGCTCGTGACGCGTCTGCAGCGCTC
AGCCACGGCGATAGCATCCTGCGATACAGATCTCCTGGTGCTGGATCGAGATCGTCTGCACATGATGATGGCGGCCTTGCCTGGAGTAACTGTTCGTCAT
GAGATGGTTGAGAGAGCAGAGCTTTTGTCGCGGCTCGATTTCTTCAAAGGCTGTGACTTTGGACAGTGCATCCGCGTTGCCCACGACATGCAGCAAGTTA
TGTACGAGCCGCACCATTTGTTTCTGAAGGAGTCAGTGCATCTGAGGACGCTTTATATCGTCAAGCGCGGCGAGATCGCAGTTTTTCTCAAG