Description :
From Genome Similarity Track
Location :
Scaffold_53:154931- 159741
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16063DEAD/DEAH box RNA helicase
Phypa_INRA-310PPTG_16064U4/U6 small nuclear ribonucleoprotein Prp31
Phypa_INRA-310PPTG_16065hypothetical protein

Sequence
4810 bases(100 bases per row)
GCAACTGAACGGGATTTCGTTTCTCCCTCAATTCGGAATTAGCGGTTGAAATCGGAATTAAGTGACTTGAAATTTATGCAATGTTTTTTATCTTCGATCC
TGGACAATCCAGGATTAGAATCCTGTACAAAACAGTACTAATAATCCTGGCCTCCAACGGTTTCGAAAAAAAAACAAGTGCTTCTGAGTGCCTGCGGGTG
GCCCAGGAGCAGCTGATTGCTCGAAAGAGCTTCTCAAGCATTACTATTTTGCTTTGCGGTGGTGTCAGTTTTAGGAATTAGTAGTATACCTAGTTTCTAC
CGACTCATCCTTCGTTGCAATAAATTACGATTGGGTTCTAGTGATGAGGAAGTCACCTGGCATTCTACAGCAAAATCCAGTCACCGAGACGCAGAGCTGA
AGCTAATTCACTTGATCTTTGCAGTCTCCGCACAGTGACCTTGATGGTTTATCTACGGCTGTTGCCTCCACGGTTGCCACCACCATTGCGGCCGACATTG
AGGTTACCGGCATTGTCGCGCGTGTACGGCGACGGCTCGATGCCAGGCACGCCGAGGAGGTTCATCTTCTTGAGAGTCTTCTTCTCGAGCTTAGGCACTT
CGTCCAGACCAATGATACGACTGTAATCGGCTGCAAGCTGCACGAGTTCCACGGGCTTCAGTTTCAAACGCCTCGAGTTCGAGTTGTAGAAACCGAGCCA
AGCCTGGTACGACTGCTGAGCCGATTTCTCCACGTCACTGTAGCTCTTCAGACTCTTGATAACCTTCAAAGCACGCGACTGCGACGGTGCTAGCGTCTCC
GGAACGTGCTTCTTGCTGGGCTCCAGAGGTAAATCAGCCAACTTGTCCAGTAGAGGCGTCTCGAACTCGGACAGAATGAGAACACCCTTGCCCTTCATAC
CAGCACGAGCTGTACGTCCAAGACGGTGGATGTATTGATCGCGATCGGTAAGACCCACTTGCAGCACGAGCGACACGTCCGGGTAGTCCACACCACGAGC
CGACACGTCCGACGAGAACATCATCACCTTGTGGCCCTTACGGAAAGCCTCAGCAGTCTTCGTGCGCACTGCCTGACTCTTACGTGAGTGAATCTCCAGG
ACACCAGGGAAACCAGCAGCTTGGAAGAGCTGCGCCATGAACTGCGCTGAACGGGCCGTCGGGAAGAACAGCATTACTTTATACGCTGAGAGCTTCATGT
GTTCAGACAGCACGCGCTCCACCATTGGGATCACTTCCTCCATCTTGCATATAACGTACTCCTGCTCGGTCTGCACGTTGGTATCCGCCTCGTTCTCGTC
GATTGTGTCCACGAACGAGTAGTCCTTACGTAAAGCGACCTGCTTGAGTTCCTCCGTGGAGGCAGGCAAAGTGGCGCTGAACAGCAGCGTCTGACGCTCC
TTCGGCAGGTATCCGATGATGCGCATGACGTCAGGACGGAATCCCATGTCCAGTAGTCGATCGGCTTCGTCCAGAATCAAGACACTGGCCTTGCCCAGAC
GGTTAACGATATTACCAGTGTTCTGCTTCAAGTGGTCGACGAGACGGCCGGGTGTGGCCACCAGGATATCAATCGGCGTGCTGCTCGTAAGCGTGCGCTC
ATCCTTCTTGATGTTAGCACCACCCACGAAACAGGCGACATTGAACTCGTGGAACTTGGTGAGACGCTTAGCCTCCGTGGAGATCTGCAGCGCCAGCTCA
CGCGTGGGCGAGATGGCCAATGTGGGGATGACGGCGCCCGAGCGACGTCCCTCCTTGACCATGTTCTCGATCACAGGAAGCAAGAAGGCGATAGTTTTGC
CGTTTCCAGTCTTGGCCTTGGCGAGCACGTCCTTGCCCTCCAGAATCAACGGAAACGTCTCGTTCTGCACGTTCGTGAGGCGCTCGTACTTGAGGTCTTC
CACGATGGCACGCTTGGTTTTGGCCGAAATGTCCAGCGAAGCAAACAGCACGTCTGATAGGTAGTCCAAATTCGCGGGCTTAGCAGTCGTGGTAGCGGGG
GTTGGAGCTTCCTGCTTCACGGGGGCGGCAGCGACAGGCGCCTGCTTGGTCTGACCGTTCGCATTGGCATTAGCGTTCTTGTTGCCGTTGTTCCGACGGC
CACCGCGACGCGGCTTCTTCTTCTTGTGCTCGGCGTCACTGTCCTTGCGTCCACCAGAAGGCGTCTTGCGGCGCCAGTTGTGGCTGTTGCTACCGTTGTT
GGCGTTCTCTTGACCAGGCATGATCTTCAGGGTTAACTTGGGTGCGTGTCAGGTCAGGAATGCGGAACTGAAGCTTCGTCTTCAGAAGTTAAACCGCCTT
CCTCCAACCGTGCCTTTTCGCCAGTTCACTTGGAGTTTGTATGCGGCTCATTGCAATTGTTGAAACTGGTATCTAGCATATTGTGGCCGTTTCTTTCCAT
AGATCTTATTCGATCTCCTCATTTGATTTTGCATTATTTTCGAAACACAATTATTTTCATTGGAAATAACCAACGTTACGATCAGAGGTCGAAGCACTGA
TGTCGACGCTTGCAGATTCATTCTTGGACGACCTGGATGAGCTGAGTGGGGGAAGCAGTGATGAGGAAGACACGCCGACGTCCTCCTACACCCCTGGCGG
TGCTTCATCCGCCGATGCCGAGACAAATGGCGACGATGACGACGAAAAGATGCCAGATGCCGCCCAATCTCGACCAGCTAAGCGGAAGCGCGAGAATGAC
GGAGAGGAGAAGAATGAAGACTTGGCCGAGTCGCTACGATCCAGCGTCAAACAGCGTGGTATAGCAGCCGTCGCGACACTCAAACGTTCGCCCAAATACC
TGGCTCACGTTCAGAAAATTCAGGAATACGTGGACGTGGACGACGCCTCTGTTACTGCCGAACCGAAGCCACTAGAAGAAGGAAGCGCTGAGTACGAGCT
GGTGGTGACTTCTAATGACTTGATGGTGCAAATTGACGACGAGATCGAGGCCATTCACCGTTTTATCGCTGATATCTACGCTGCTAAGTTCCCGGAGCTG
GACTCTCTCGTTCCCAACGCGCTGGACTACGCTCGTGTGGTCAAAGTCATTGGCAACGAGATGGACTTAACGCTTGTGGAAGAACTGCCTAAACTTCTGC
CTAGTTCAGCTGTTATTGGAATCTCCGTTACGGGTTCCGGCACCAGTGGCAAACCCCTGAGTCTTGAGGACTTGAAGACCTGCATGGAAGCGTGTGACGA
GCTACTGTCGCTGGATAAGGACAAGAATATGATCTTGCGCTTCGTGGAGAGCCGCATGAAGTATTTGGCGCCGAACGTTTCGCAGCTCGTAGGCACACGT
ATCGCTGCGCAGCTTATCGGACTTGCTGGCGGGGTGGCGCAACTTGCACGGATCCCGTCGTGCAACTTGCAGGTGTTGGGACAAGAAAAGAAAGTTTTGA
GTGGCTTTTCATCCGCTGCAGCGCTCAAGCATACAGGTGTCCTGTTCTTCAGTGACCTCGTGCAGAGTGTGCCACCGTATTTGCGCATGAAGGCGTGTAG
AGCCGTAGCTGGCAAACTAGCGCTGATGGCACGCGTGGATAGCCAGCCTCATCAGAATGATACGGAAGGTTTAGTCGGTGCTCGCTTTCGTACCGAGTTA
GTTGGTAAGATGGAGAAATGGCAAGAACCCCAGAAGGCCAAGACGAAGAAGGCGCTGCCTATTCCAGACGAGAAACCGCGCCGCAAACGCGGTGGCAAGC
GCTACCGCAAGATGAAAGAGCGGCTGCAGATGACAGATGTGCGACGTGAAATGAACCGGCAGTCGTTCGCTACAGCTGACGAAGAGTATGGTGACAACGC
AATGGGAATTACATCTGGCCGTCTTGGCCAAGAAGGATCGGGCAATTTGCGTATTATGCGCAAGGAACAGAAGCAGTCAAGCAAAAAATTGCGCGCTGCC
AACTTTGCTGCGTCTTCTGCTAGCAAGCCGCCGCTTTCTGGTTTGGCATCAAGTCTTGCGTTCACACCTGTGCAAGGCATTGAGCTCATGAACCCTGAAG
CTGCGAAGGCTCGCGTTGCCGAGGCCAATAAGAAGTACTTTTCTGCTGCTAGTGGCTTCGTCAGTGTTGTCAAAAAGCCCTGAACGTCGCTCCCGCTGGC
AGTGTATGAATCCCTTTCGAGCAATAACCATATTCAGAAATGAATCTAGCATTTTGATTAGTGCAATTGATGTATATTCTGTAAAGTTGGACCATGTATC
TACCAGGTAACTAACTAGGCAAGGCAATAGTCACCTGTGAGTTGACAACCTTGTCCGAAATACGTTCAATTGAGCACGTGTGGCACCTACACAGTGACTG
TGTTTGTCAATTCAGCGCCTAGGATCTCGAGCGTCGTAATCGATTGTGCTAGTAGATCCGCGGAGAACCTGGCACTTTGGCCAAAGAGAATGTCGATGCT
CGAGGTTTTGTACACAGCTCCAGTGGTAGAGTTTGGCTCCGTTGTCCAAGTATTTATCGGTCCATCAACATATTCCAGAGCAGACAAGTCGAATGTGACA
GTTTGAGCGTCTCCGAAGTTCGTCGCCACGATCACCATCACTTGGGTGTTTTCGTCGTATGCAACAACGAAGTTCGGATACTTGTCCAAAGCATACGAGG
ATGATCCAGGAAGCAAAGTGTTTGGATCATCGAACTTCAAGATGCTCATGCCAGCGTGAATGTGGCGAGAGTAGTGGGCCATCACGTAGTGCTTTGGGTT
TGCACTGCCGATCCAATTGTCTCCCGGGTTCGACTGAATGAGTCCCAGCACTCCACTATCAAGCGCTTGCTTGTAAACGAACGCTGAAGCACCCATTTCG
TTGATGTCTC