Description :
From Genome Similarity Track
Location :
Scaffold_389:15491- 18405
Sequence
2914 bases(100 bases per row)
TCACTTCTTCCTCCTAATACACCCAGTGTCTTCGTCTTCTTTTTCTTTCCGATGTGACCAACTCATATCAGCGATCCTCCTCCTCCTGACCCACACCCTT
CCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTT
ACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCATCGTCTACCCAACTAGGTTCGTCATGTCCACGCCAATGCACC
AGAAACTCACGGTAAATCCGTCCGTATCTCGTTCGCTTCCCCGATCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCC
AACTGTCTTCCGGTAGGAGAACTTCGTCGAAGTCGACGCGGTCGGATGCATCTACCAAAAGACGGACCTGCGGCCGATCCGGATATTCTTTGACCAACTT
CAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTCACCGCATGTTCTCCAATCTTCTCTCTCACCCGGAACGGT
CCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATACAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGT
CTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCATTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCA
TCGCCTTGGATCTCGGTTTCTCTTCTTGGTACTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGCGTA
TCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTTTGATCCAAATCCTGGACATACATCTTGA
GTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGTTGAA
TGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGGTCATGTCTAATCATTTCGCTAGCACCAAATCTTCGGAAAACACACTCCTCGTACGATTCCGCA
ATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAAAAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGG
GCAACGAGGGAATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGGACATTCCCAGGTGACTCCCCTTCGATCGTAGGTCTGCCCTTGCCTGT
CTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCCAATGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATGCCC
TGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTGGA
CTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCGTTCAGATCCACTGCGTAATCCGTAGCGATAACGCTGTAGGATTTGGCATCCTCCCGACTTAAGTC
TCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCATTCTGTGCTTTGAGGATCCGCTCGATGCGAACTCTCTTCACGAATGTT
TCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGCGACGGCCATCACCTGGACTGTCCTTTTTCCGGATCCCACTACCACCACTTCGT
CTAGTCGGTGCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACT
GGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAAGTGGATCATCACTTTCTGTCGTAACAGTGTTAGGGCCGGGGCCTTG
CAGTCAATCTCACCTCGCACCTGTCTGATCCAAATTTGAATCCCCACAAATCCCCAGCCTTTTTGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGG
AGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACCTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGT
ATGTCCCTCCTCCGCGTCGTACGCGAGCGGATCCATCAAAAATCAGGACGTACAGATCCTCGTCCACTTGTACCGTCGGGATCGGGATCTGGATCCGGCG
TTTGGGCTCTTTCTTAGTAGCGATCCTAGTCAGCGCCTCATCCATCGTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCT
TTCGAACATTTCACAATCTCCAGTGTCCAAGGCTATAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAAAAGCCAGGCTAGCG
TAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGATCACAAGTACCTCTTTCTCCATTGCTCC
GTAGTTCAGTTTATTCGGCTTCTGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCG
CTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCATAATGACGGAGGACAGGTGTGGTCGCGATCCTGTTCCTCAGCTCCACGAATGCGTGTTGAG
CTCGGATCCACCGA