Description :
From Genome Similarity Track
Location :
Scaffold_1344:1549- 5106
Sequence
3557 bases(100 bases per row)
TCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTACATCGCCCGTAACGACTGTGGGA
AGGACAAGTCTGCTAGCGAAGACAGGTCCTTAGCATTAGCCTCCAATCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATA
GCTCTTCACCACGCTGATAGAGAGATTCCACTAAGTACACGCCTCCAGTAGGGATGTCACTCTCTCGCACAACTGATCCCACGATTCTGCCGGGATTAAA
ATGTCGTCGATATAAGATCTGCGTTCTAACACAGACGAGGTCCCAGGATCCCCTGGCTCTCCTGCTTCGAACGGATCCACTTCCGTATGATCTTCTCCGG
ATCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCGTAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGCGCGTTCTTCAATCCAAACGGCAT
CCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGAAATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTTGCCATTTCTAGA
GAACAGTACCAGAGTACTTTATCCAAAGCCTCCAATAGCTCCTTGATTAGAGGCATTGTATACATCATCAGTCGGGTCAGACCGTTAACCATCTGGTAAT
CAATACACAGACGTATACCCACTCCGTTCTTCTTAACGATGATTATCACCGGAGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAT
GCCCTTAATCAGATCCGATAGTGTTTCTCGGAACTGAGGTGTCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTG
ACTCCGCGGGCAGCGGGCGGTAATGCATTACCTTTATCAGTCAGCAGATGTCGGCTCTCCCAGATCTTCTGACGTAACCGATCCACTTCCGCGAGTTCGT
TCGCCCCTGGATCCACTTGGATATCGTCAATCGTGACCTCCTCTGTGGTTAGTGGTACCTCCGGGATCACCGCCAGGCTTTCTTCGAGATCCTCGGCGTG
TAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACCCTCTTTCACCTGTCATCCCT
TCTGTCTTCGTGGGATCAGGTACCCTGGTACCGGGGAAGCCACCAGTTGGATCGACTTGATCCTCTAGCGAGTTTAAACACGACGGTTCTTGTTTGACTA
GTGTTGCCACTCTCGATAAGGATCCAGGCACTTTGTCCCATGAAAAGCTAGGATCCACTCGGGGGTTAGCAGGATCTGGCGACCCGGCTTCGGCCCTCCG
CGATTCTTCATCCATCGACCCTGAGTTATCTAGGGACCGGTTCTGGGGATCATCCCCGGTCTTGGATCCAACCTCTATCGCTTGGATCCCAATCCGACGA
TCTCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCAACCAAGGGGCCAGTTGGCCCCGCCGGGAGCTCCACCTATCCAAGGGATTCGATCT
CGGTAGTCGCCTCGTACACCGGATTCTGCCATTCTCTGTAGCGACGGGATCCTACTGACACATATCCAGGTCGCCTAGGGATGCCGGCCTTCGCCAACCA
TCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGGATTACTGTAGAC
ACCCACTTCTCACCCCGAGTGATCCACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTCTCCGGGCTCGAACCAGGTTGTCTT
ATCCGCCCTTAGGATCCTCATCTTCGCCCCGTACAGCGATCGTCGTCCACTGAGCTGGATCCACATCTCGTGCGGGAAACACAGTGTCCCATCTGCCAGA
TCCAACTTTACCCCGGCTGGTACCATGACATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCCATTCGTACGGTACACGCCTTCACCAATCCCA
ACACAATCTTGGATCCGGCTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACGCCTCGGCACCACTATCTAGGAGTAGGA
TTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCATTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCACTGGCAGCAG
ATCCATGGATCCAACATCTTCAGATCCACGGGATCCAGTGAGCTGACAAACCTTGGGTGGATCAGCAGTGACCTCACCCTTGGTAGGCTCAAACCATTGG
CCATGTTGTCGTTTCTCTTAGTACCCGCGCGCTTCTCAAACCAGAGTTGAAGAGACTTCGGAACTGGCGAATTCATCCACGTGGCGCAAACTAGAAACCT
TGACAACTGACACTTCATGTAGATCACATGTATTATCGACTGGATCTAGGGGCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCA
ATACCTAGAACGCTCGGCTCGTACCGGATTCAAAACCGGCGAGCGTCCTAGTTTAATATCTTCTCTGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTG
GATCGAAACATTGGCGAATCTGGTTGTAGAACTCTTCCATCGGGCACTTGCCGGCGTCGTGGATCTCGCCACAACCGCGACACACGTAAAAACAATGAAA
ACGGGATGACCCTTCGTGCCACACTTCTCACAAACCAGATGTTTCCAGCACCCAGCTTCTGTGTGCTTCTGGGATCCACACTGCGAGCACCCGATTTGCC
CTGTCCCGTCCATCAGCTCTCGATATGTGTACATACCACGGTCCCCGGATACGGTATCACCAGTGCGAGAGTTGTCTCCAGTCTTCGCCGTACGATCGTT
GGGTGCAGTGAGACAGATTCTGCGGTAATCCTCTGGATCGAAGTCCGAACCATCGGATCCCGATTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACA
CGTCGCGCTGGGGCCGTGGGTGTCGGAGCTTTTTGGCGATACTTGCCAGATCCGACCGCCTTCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCA
GCACTTCTTCAAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGCCGGCCAGATCCACATCTCCGAATGTCTCGATGAAATTATCCACGTGTTC
CCGTAGTACCTTGGATCCCTCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATCTAGCCGATGCAGATATTCAAGCGGGGATTTATCCGATCTG
CGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACCCCCAATCCACAGTACTGGGTTTGGAAACTGCGCAGCAAATCCGGCCACTTGTTCCTGGTGGATC
TGTTCAGCTGCCGATACCAGTTTCTGGCTGACCCCGCTAGCAGATCCGCAAAGAACA